0610037L13Rik | GeneID:74098 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 74098 Official Symbol 0610037L13Rik
Locus RP23-40G2.3 Gene Type protein-coding
Synonyms 1110008H16Rik
Full Name RIKEN cDNA 0610037L13 gene
Description RIKEN cDNA 0610037L13 gene
Chromosome 4 C7
Also Known As OTTMUSP00000009578; hypothetical protein LOC74098
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 41206

ID Symbol Protein Species
GeneID:36459 CG4646 NP_610848.1 Drosophila melanogaster
GeneID:54987 C1orf123 NP_060357.1 Homo sapiens
GeneID:74098 0610037L13Rik NP_083030.1 Mus musculus
GeneID:179370 F46B6.12 NP_505521.1 Caenorhabditis elegans
GeneID:298384 RGD1559786 NP_001029304.1 Rattus norvegicus
GeneID:424650 LOC424650 XP_422484.1 Gallus gallus
GeneID:456863 LOC456863 XP_513414.2 Pan troglodytes
GeneID:479563 LOC479563 XP_536703.2 Canis lupus familiaris
GeneID:517857 C3H1orf123 NP_001033219.1 Bos taurus
GeneID:555997 si:ch211-284b7.3 XP_683779.1 Danio rerio
GeneID:829430 AT4G32930 NP_567911.1 Arabidopsis thaliana
GeneID:1278742 AgaP_AGAP003919 XP_318370.2 Anopheles gambiae
GeneID:4327927 Os01g0565600 NP_001043357.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0003674 Function molecular_function
GO:0008150 Process biological_process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_028754  UCSC Browser NP_083030

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000030346 MI0001446 hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
ENSMUST00000030346 MI0003624 hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC
ENSMUST00000030346 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENSMUST00000030346 MI0003660 hsa-miR-645 UCUAGGCUGGUACUGCUGA
ENSMUST00000030346 MI0003763 hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU
ENSMUST00000030346 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENSMUST00000030346 MI0003834 hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU
ENSMUST00000030346 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENSMUST00000030346 MI0005768 hsa-miR-943 CUGACUGUUGCCGUCCUCCAG
ENSMUST00000030346 MI0000587 mmu-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSMUST00000030346 MI0000588 mmu-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSMUST00000030346 MI0000684 mmu-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENSMUST00000030346 MI0000161 mmu-miR-135a* UAUAGGGAUUGGAGCCGUGGCG
ENSMUST00000030346 MI0000163 mmu-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENSMUST00000030346 MI0000172 mmu-miR-150* CUGGUACAGGCCUGGGGGAUAG
ENSMUST00000030346 MI0000564 mmu-miR-15a UAGCAGCACAUAAUGGUUUGUG
ENSMUST00000030346 MI0000140 mmu-miR-15b UAGCAGCACAUCAUGGUUUACA
ENSMUST00000030346 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENSMUST00000030346 MI0000619 mmu-miR-338-5p AACAAUAUCCUGGUGCUGAGUG
ENSMUST00000030346 MI0004679 mmu-miR-455* UAUGUGCCUUUGGACUACAUCG
ENSMUST00000030346 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENSMUST00000030346 MI0003492 mmu-miR-485 AGAGGCUGGCCGUGAUGAAUUC
ENSMUST00000030346 MI0004589 mmu-miR-496 UGAGUAUUACAUGGCCAAUCUC
ENSMUST00000030346 MI0004636 mmu-miR-497 CAGCAGCACACUGUGGUUUGUA
ENSMUST00000030346 MI0005515 mmu-miR-504 AGACCCUGGUCUGCACUCUAUC
ENSMUST00000030346 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG
ENSMUST00000030346 MI0004601 mmu-miR-673-5p CUCACAGCUCUGGUCCUUGGAG
ENSMUST00000030346 MI0004662 mmu-miR-693-5p CAGCCACAUCCGAAAGUUUUC
ENSMUST00000030346 MI0004605 mmu-miR-760 CGGCUCUGGGUCUGUGGGGA
ENSMUST00000030346 MI0000157 mmu-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSMUST00000030346 MI0000720 mmu-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSMUST00000030346 MI0000721 mmu-miR-9 UCUUUGGUUAUCUAGCUGUAUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  2. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  7. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  8. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  9. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
  10. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548