0610012H03Rik | GeneID:74088 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 74088 Official Symbol 0610012H03Rik
Locus RP23-444H3.1 Gene Type protein-coding
Synonyms
Full Name RIKEN cDNA 0610012H03 gene
Description RIKEN cDNA 0610012H03 gene
Chromosome 2 E3
Also Known As OTTMUSP00000015955; hypothetical protein LOC74088
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 105742

ID Symbol Protein Species
GeneID:74088 0610012H03Rik NP_083023.1 Mus musculus
GeneID:614914 LOC614914 XP_871659.1 Bos taurus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005739 Component mitochondrion
GO:0003674 Function molecular_function
GO:0008150 Process biological_process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001159638  UCSC Browser NP_001153110
2 NM_028747  UCSC Browser NP_083023

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000068813 MI0000779 hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU
ENSMUST00000068813 MI0003562 hsa-miR-556-3p AUAUUACCAUUAGCUCAUCUUU
ENSMUST00000068813 MI0003576 hsa-miR-569 AGUUAAUGAAUCCUGGAAAGU
ENSMUST00000068813 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENSMUST00000068813 MI0003656 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC
ENSMUST00000068813 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENSMUST00000068813 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENSMUST00000068813 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENSMUST00000068813 MI0000153 mmu-miR-126-3p UCGUACCGUGAGUAAUAAUGCG
ENSMUST00000068813 MI0005482 mmu-miR-147 GUGUGCGGAAAUGCUUCUGCUA
ENSMUST00000068813 MI0000174 mmu-miR-152 UCAGUGCAUGACAGAACUUGG
ENSMUST00000068813 MI0000224 mmu-miR-182 UUUGGCAAUGGUAGAACUCACACCG
ENSMUST00000068813 MI0000245 mmu-miR-202-3p AGAGGUAUAGCGCAUGGGAAGA
ENSMUST00000068813 MI0000797 mmu-miR-380-5p AUGGUUGACCAUAGAACAUGCG
ENSMUST00000068813 MI0004645 mmu-miR-449c AGGCAGUGCAUUGCUAGCUGG
ENSMUST00000068813 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENSMUST00000068813 MI0004673 mmu-miR-669c AUAGUUGUGUGUGGAUGUGUGU
ENSMUST00000068813 MI0005207 mmu-miR-743a GAAAGACACCAAGCUGAGUAGA
ENSMUST00000068813 MI0005470 mmu-miR-743b-3p GAAAGACAUCAUGCUGAAUAGA
ENSMUST00000068813 MI0005476 mmu-miR-883a-5p UGCUGAGAGAAGUAGCAGUUAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  2. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  3. [ + ] Mootha VK, et al. (2003) "Integrated analysis of protein composition, tissue diversity, and gene regulation in mouse mitochondria." Cell. 115(5):629-640. PMID:14651853
  4. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  7. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  8. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  9. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636