AAK1 | GeneID:736127 | Pan troglodytes

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 736127 Official Symbol AAK1
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description AP2 associated kinase 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 75032

ID Symbol Protein Species
GeneID:22848 AAK1 NP_055726.3 Homo sapiens
GeneID:269774 Aak1 NP_001035195.1 Mus musculus
GeneID:419512 AAK1 XP_417663.2 Gallus gallus
GeneID:474625 AAK1 XP_531855.2 Canis lupus familiaris
GeneID:500244 Aak1 XP_575594.2 Rattus norvegicus
GeneID:532546 AAK1 XP_611658.3 Bos taurus
GeneID:736127 AAK1 XP_001138098.1 Pan troglodytes
GeneID:817846 AT2G32850 NP_565756.1 Arabidopsis thaliana
GeneID:4346601 Os09g0279100 NP_001062756.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001137936 XP_001137936
2 XM_001138098 XP_001138098
3 XM_001138187 XP_001138187

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSPTRT00000022364 MI0001725 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENSPTRT00000022364 MI0001726 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENSPTRT00000022364 MI0000775 hsa-miR-367 AAUUGCACUUUAGCAAUGGUGA
ENSPTRT00000022364 MI0001723 hsa-miR-433 AUCAUGAUGGGCUCCUCGGUGU
ENSPTRT00000022364 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSPTRT00000022364 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSPTRT00000022364 MI0003171 hsa-miR-518d-3p CAAAGCGCUUCCCUUUGGAGC
ENSPTRT00000022364 MI0003516 hsa-miR-545 UCAGCAAACAUUUAUUGUGUGC
ENSPTRT00000022364 MI0005763 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSPTRT00000022364 MI0005764 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSPTRT00000022364 MI0005765 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSPTRT00000022364 MI0005766 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSPTRT00000022364 MI0004690 mmu-miR-706 AGAGAAACCCUGUCUCAAAAAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]