abcg2d | GeneID:735310 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 735310 Official Symbol abcg2d
Locus DKEY-192D9.3 Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family G (WHITE), member 2d
Description ATP-binding cassette, sub-family G (WHITE), member 2d
Chromosome N/A
Also Known As ATP-binding cassette transporter sub-family G member 2d
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55852

ID Symbol Protein Species
GeneID:9429 ABCG2 NP_004818.2 Homo sapiens
GeneID:26357 Abcg2 NP_036050.1 Mus musculus
GeneID:312382 Abcg2 NP_852046.1 Rattus norvegicus
GeneID:423767 ABCG2 XP_421638.2 Gallus gallus
GeneID:471251 ABCG2 XP_526633.2 Pan troglodytes
GeneID:478472 ABCG2 XP_535650.2 Canis lupus familiaris
GeneID:536203 ABCG2 NP_001032555.2 Bos taurus
GeneID:735310 abcg2d NP_001036237.1 Danio rerio
GeneID:811826 PF14_0244 XP_001348418.1 Plasmodium falciparum
GeneID:830541 AT5G06530 NP_850781.2 Arabidopsis thaliana
GeneID:850369 ADP1 NP_009937.2 Saccharomyces cerevisiae
GeneID:2679509 MGG_01563 XP_363637.2 Magnaporthe grisea
GeneID:2713604 NCU02544.1 XP_331743.1 Neurospora crassa
GeneID:2892892 KLLA0D04554g XP_453265.1 Kluyveromyces lactis
GeneID:4331674 Os03g0157400 NP_001049014.1 Oryza sativa
GeneID:4621257 AGOS_AER190W NP_985047.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001042772 NP_001036237

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000022733 MI0001904 dre-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENSDART00000022733 MI0001905 dre-miR-19c UGUGCAAAUCCAUGCAAAACUCG
ENSDART00000022733 MI0001906 dre-miR-19d UGUGCAAACCCAUGCAAAACUGA
ENSDART00000022733 MI0001383 dre-miR-217 UACUGCAUCAGGAACUGAUUGG
ENSDART00000022733 MI0002050 dre-miR-217 UACUGCAUCAGGAACUGAUUGG
ENSDART00000022733 MI0004785 dre-miR-739 AGGCCGAAGUGGAGAAGGGUU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Kobayashi I, et al. (2008) "Characterization and localization of side population (SP) cells in zebrafish kidney hematopoietic tissue." Blood. 111(3):1131-1137. PMID:17932252
  2. [ + ] Annilo T, et al. (2006) "Evolution of the vertebrate ABC gene family: analysis of gene birth and death." Genomics. 88(1):1-11. PMID:16631343
  3. [ + ] Dean M, et al. (2005) "Evolution of the ATP-binding cassette (ABC) transporter superfamily in vertebrates." Annu Rev Genomics Hum Genet. 6():123-142. PMID:16124856