TXNRD1 | GeneID:7296 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 7296 Official Symbol TXNRD1
Locus N/A Gene Type protein-coding
Synonyms GRIM-12; MGC9145; TR; TR1; TRXR1; TXNR
Full Name thioredoxin reductase 1
Description thioredoxin reductase 1
Chromosome 12q23-q24.1
Also Known As KM-102-derived reductase-like factor; oxidoreductase; thioredoxin reductase GRIM-12
Summary This gene encodes a member of the family of pyridine nucleotide oxidoreductases. This protein reduces thioredoxins as well as other substrates, and plays a role in selenium metabolism and protection against oxidative stress. The functional enzyme is thought to be a homodimer which uses FAD as a cofactor. Each subunit contains a selenocysteine (Sec) residue which is required for catalytic activity. The selenocysteine is encoded by the UGA codon that normally signals translation termination. The 3' UTR of selenocysteine-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Alternative splicing results in several transcript variants encoding the same or different isoforms. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55733

ID Symbol Protein Species
GeneID:7296 TXNRD1 NP_001087240.1 Homo sapiens
GeneID:50493 Txnrd1 NP_001035988.1 Mus musculus
GeneID:58819 Txnrd1 NP_113802.2 Rattus norvegicus
GeneID:177466 trxr-1 NP_501085.2 Caenorhabditis elegans
GeneID:282388 TXNRD1 NP_777050.1 Bos taurus
GeneID:467112 TXNRD1 XP_522512.2 Pan troglodytes
GeneID:474536 TXNRD1 XP_531765.2 Canis lupus familiaris

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab16847 TXNRD1 antibody [19A1] (ab16847); Mouse monoclonal [19A1] to TXNRD1
2 abcam ab16851 TXNRD1 antibody [5A5] (ab16851); Mouse monoclonal [5A5] to TXNRD1
3 abcam ab16840 TXNRD1 antibody (ab16840); Rabbit polyclonal to TXNRD1
4 acris AP16041PU-N Thioredoxin reductase 1 (TXNRD1) (C-term); antibody Ab
5 scbt TXNRD1 TXNRD1 Antibody / TXNRD1 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of TXNRD1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of TXNRD1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005829 Component cytosol
GO:0005634 Component nucleus
GO:0009055 Function electron carrier activity
GO:0050660 Function FAD binding
GO:0050661 Function NADP or NADPH binding
GO:0016491 Function oxidoreductase activity
GO:0015035 Function protein disulfide oxidoreductase activity
GO:0008430 Function selenium binding
GO:0004791 Function thioredoxin-disulfide reductase activity
GO:0045454 Process cell redox homeostasis
GO:0022900 Process electron transport chain
GO:0007165 Process signal transduction
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001093771  UCSC Browser NP_001087240
2 NM_003330  UCSC Browser NP_003321
3 NM_182729  UCSC Browser NP_877393
4 NM_182742  UCSC Browser NP_877419
5 NM_182743  UCSC Browser NP_877420

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000354940 MI0000108 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000354940 MI0000109 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000354940 MI0000475 hsa-miR-136* CAUCAUCGUCUCAAAUGAGUCU
ENST00000354940 MI0000463 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENST00000354940 MI0000464 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENST00000354940 MI0000438 hsa-miR-15b* CGAAUCAUUAUUUGCUGCUCUA
ENST00000354940 MI0000272 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU
ENST00000354940 MI0000484 hsa-miR-188-5p CAUCCCUUGCAUGGUGGAGGG
ENST00000354940 MI0000488 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
ENST00000354940 MI0000732 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
ENST00000354940 MI0000242 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000354940 MI0000281 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000354940 MI0000282 hsa-miR-199b-5p CCCAGUGUUUAGACUAUCUGUUC
ENST00000354940 MI0000296 hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG
ENST00000354940 MI0000078 hsa-miR-22 AAGCUGCCAGUUGAAGAACUGU
ENST00000354940 MI0000813 hsa-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
ENST00000354940 MI0000825 hsa-miR-345 GCUGACUCCUAGUCCAGGGCUC
ENST00000354940 MI0000826 hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU
ENST00000354940 MI0001735 hsa-miR-409-5p AGGUUACCCGAGCAACUUUGCAU
ENST00000354940 MI0002471 hsa-miR-487a AAUCAUACAGGGACAUCCAGUU
ENST00000354940 MI0003530 hsa-miR-487b AAUCGUACAGGGUCAUCCACUU
ENST00000354940 MI0003125 hsa-miR-490-5p CCAUGGAUCUCCAGGUGGGU
ENST00000354940 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENST00000354940 MI0003573 hsa-miR-567 AGUAUGUUCUUCCAGGACAGAAC
ENST00000354940 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENST00000354940 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENST00000354940 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENST00000354940 MI0003676 hsa-miR-654-3p UAUGUCUGCUGACCAUCACCUU
ENST00000354940 MI0005563 hsa-miR-665 ACCAGGAGGCUGAGGCCCCU
ENST00000354940 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENST00000354940 MI0000466 hsa-miR-9* AUAAAGCUAGAUAACCGAAAGU
ENST00000354940 MI0000467 hsa-miR-9* AUAAAGCUAGAUAACCGAAAGU
ENST00000354940 MI0000468 hsa-miR-9* AUAAAGCUAGAUAACCGAAAGU
ENST00000354940 MI0004649 mmu-miR-685 UCAAUGGCUGAGGUGAGGCAC
ENST00000354940 MI0004684 mmu-miR-700 CACGCGGGAACCGAGUCCACC
ENST00000354940 MI0005207 mmu-miR-743a GAAAGACACCAAGCUGAGUAGA
ENST00000354940 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA
ENST00000378070 MI0000471 hsa-miR-126 UCGUACCGUGAGUAAUAAUGCG
ENST00000378070 MI0000452 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000378070 MI0000453 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000378070 MI0000810 hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUGA
ENST00000378070 MI0000455 hsa-miR-138-2* GCUAUUUCACGACACCAGGGUU
ENST00000378070 MI0000274 hsa-miR-187* GGCUACAACACAGGACCCGGGC
ENST00000378070 MI0003130 hsa-miR-202* UUCCUAUGCAUAUACUUCUUUG
ENST00000378070 MI0000744 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
ENST00000378070 MI0005568 hsa-miR-301b CAGUGCAAUGAUAUUGUCAAAGC
ENST00000378070 MI0000090 hsa-miR-32 UAUUGCACAUUACUAAGUUGCA
ENST00000378070 MI0000090 hsa-miR-32* CAAUUUAGUGUGUGUGAUAUUU
ENST00000378070 MI0000742 hsa-miR-34b* UAGGCAGUGUCAUUAGCUGAUUG
ENST00000378070 MI0003132 hsa-miR-493* UUGUACAUGGUAGGCUUUCAUU
ENST00000378070 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENST00000378070 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENST00000378070 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENST00000378070 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENST00000378070 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENST00000378070 MI0003145 hsa-miR-519e* UUCUCCAAAAGGGAGCACUUUC
ENST00000378070 MI0003564 hsa-miR-558 UGAGCUGCUGUACCAAAAU
ENST00000378070 MI0003654 hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU
ENST00000378070 MI0003658 hsa-miR-643 ACUUGUAUGCUAGCUCAGGUAG
ENST00000378070 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENST00000378070 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000378070 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000378070 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000378070 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENST00000378070 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENST00000378070 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENST00000378070 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENST00000378070 MI0002405 mmu-miR-470 UUCUUGGACUGGCACUGGUGAGU
ENST00000388854 MI0000080 hsa-miR-24-1* UGCCUACUGAGCUGAUAUCAGU
ENST00000388854 MI0000466 hsa-miR-9* AUAAAGCUAGAUAACCGAAAGU
ENST00000388854 MI0000467 hsa-miR-9* AUAAAGCUAGAUAACCGAAAGU
ENST00000388854 MI0000468 hsa-miR-9* AUAAAGCUAGAUAACCGAAAGU
ENST00000388854 MI0002637 mml-miR-189 GUGCCUACUGAGCUGAUAUCAGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
(1,2-bis(1,2-benzisoselenazolone-3(2H)-ketone))ethane
  • (1,2-bis(1,2-benzisoselenazolone-3(2H)-ketone))ethane results in decreased activity of TXNRD1 protein
15982805
1-(5-isoquinolinylsulfonyl)-3-methylpiperazine
  • 1-(5-isoquinolinylsulfonyl)-3-methylpiperazine inhibits the reaction [sulforafan results in increased expression of TXNRD1 mRNA]
12663510
1-Naphthylisothiocyanate
  • 1-Naphthylisothiocyanate results in decreased expression of TXNRD1 mRNA
17522070
2,3-dimethoxy-1,4-naphthoquinone
  • 2,3-dimethoxy-1,4-naphthoquinone results in increased expression of TXNRD1 mRNA
17547211
2-tert-butylhydroquinone
  • 2-tert-butylhydroquinone results in increased expression of TXNRD1 mRNA
16014739
4-hydroxytamoxifen
  • 4-hydroxytamoxifen results in decreased expression of TXNRD1 mRNA
16514628
Acetaminophen
  • Acetaminophen results in increased expression of TXNRD1 mRNA
17202762, 17202758
Acetaminophen
  • Acetaminophen results in decreased expression of TXNRD1 mRNA
17522070
Acetaminophen
  • Acetaminophen affects the expression of TXNRD1 mRNA
17562736
Acetylcysteine
  • Acetylcysteine inhibits the reaction [Acrolein results in increased expression of TXNRD1 mRNA]
15652504
Acrolein
  • Acrolein results in decreased activity of TXNRD1 protein
15652504, 15388247
Acrolein
  • Acetylcysteine inhibits the reaction [Acrolein results in increased expression of TXNRD1 mRNA]
  • Acrolein results in increased expression of TXNRD1 mRNA
  • Cycloheximide inhibits the reaction [Acrolein results in increased expression of TXNRD1 mRNA]
  • Dactinomycin inhibits the reaction [Acrolein results in increased expression of TXNRD1 mRNA]
15652504
Antimony
  • Antimony results in increased expression of TXNRD1 mRNA
17547211
Antimony Potassium Tartrate
  • Antimony Potassium Tartrate results in increased expression of TXNRD1 mRNA
17547211
arsenite
  • [arsenite co-treated with Benzo(a)pyrene] results in increased expression of TXNRD1 mRNA
  • arsenite results in increased expression of TXNRD1 mRNA
15894712
Auranofin
  • Auranofin results in decreased activity of TXNRD1 protein
16510263
Benzo(a)pyrene
  • Benzo(a)pyrene results in increased expression of TXNRD1 mRNA
  • [arsenite co-treated with Benzo(a)pyrene] results in increased expression of TXNRD1 mRNA
15894712
bis(tri-n-butyltin)oxide
  • bis(tri-n-butyltin)oxide results in increased expression of TXNRD1 mRNA
17553608
Buthionine Sulfoximine
  • Buthionine Sulfoximine inhibits the reaction [sulforafan results in increased expression of TXNRD1 mRNA]
  • Buthionine Sulfoximine promotes the reaction [Sodium Selenite results in increased activity of TXNRD1 protein]
  • Buthionine Sulfoximine results in increased expression of TXNRD1 mRNA
12663510
Cadmium
  • Cadmium results in increased expression of TXNRD1 mRNA
17547211
Cadmium Chloride
  • Cadmium Chloride results in increased expression of TXNRD1 mRNA
17547211, 15521073
Cadmium Chloride
  • Cadmium Chloride results in increased expression of TXNRD1 mRNA
  • Cadmium Chloride promotes the reaction [NFE2L2 protein binds to TXNRD1 promoter]
15521073
Calcitriol
  • Calcitriol results in increased expression of TXNRD1 mRNA
16002434
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of TXNRD1 mRNA
17202758
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased activity of TXNRD1 protein
18215477
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of TXNRD1 mRNA
17522070
Chloroform
  • Chloroform results in decreased expression of TXNRD1 mRNA
17522070
cholestane-3,5,6-triol
  • Sodium Selenite inhibits the reaction [cholestane-3,5,6-triol results in increased expression of TXNRD1 mRNA]
  • cholestane-3,5,6-triol results in increased expression of TXNRD1 mRNA
16039982
cyanoginosin LR
  • cyanoginosin LR results in increased expression of TXNRD1 mRNA
17654400
Cycloheximide
  • Cycloheximide inhibits the reaction [Acrolein results in increased expression of TXNRD1 mRNA]
15652504
Cycloheximide
  • Cycloheximide inhibits the reaction [sulforafan results in increased expression of TXNRD1 mRNA]
12663510
Dactinomycin
  • Dactinomycin inhibits the reaction [Acrolein results in increased expression of TXNRD1 mRNA]
15652504
Dactinomycin
  • Dactinomycin inhibits the reaction [sulforafan results in increased expression of TXNRD1 mRNA]
12663510
dicyclanil
  • dicyclanil results in increased expression of TXNRD1 mRNA
15664270
diethyl maleate
  • diethyl maleate results in increased expression of TXNRD1 mRNA
  • diethyl maleate results in increased expression of TXNRD1 mRNA
15521073
Dimethylnitrosamine
  • Dimethylnitrosamine results in increased expression of TXNRD1 mRNA
17547211
Dinitrochlorobenzene
  • Dinitrochlorobenzene inhibits the reaction [TXNRD1 protein affects the metabolism of Dithionitrobenzoic Acid]
17229725
diphenyleneiodonium
  • diphenyleneiodonium inhibits the reaction [Paraquat results in increased activity of TXNRD1 protein]
  • diphenyleneiodonium inhibits the reaction [TXNRD1 protein affects the metabolism of Dithionitrobenzoic Acid]
17229725
Dithionitrobenzoic Acid
  • Dinitrochlorobenzene inhibits the reaction [TXNRD1 protein affects the metabolism of Dithionitrobenzoic Acid]
  • Gold Sodium Thiomalate inhibits the reaction [TXNRD1 protein affects the metabolism of Dithionitrobenzoic Acid]
  • TXNRD1 protein affects the metabolism of Dithionitrobenzoic Acid
  • diphenyleneiodonium inhibits the reaction [TXNRD1 protein affects the metabolism of Dithionitrobenzoic Acid]
17229725
Edetic Acid
  • Edetic Acid results in increased activity of TXNRD1 protein
  • Zinc inhibits the reaction [Edetic Acid results in increased activity of TXNRD1 protein]
16774913
Emodin
  • Emodin results in decreased expression of TXNRD1 mRNA
16045814
Erythromycin Estolate
  • Erythromycin Estolate results in decreased expression of TXNRD1 mRNA
17522070
Estradiol
  • Estradiol results in increased expression of TXNRD1 mRNA
16514628
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of TXNRD1 mRNA
17555576
Ethinyl Estradiol
  • Ethinyl Estradiol results in increased expression of TXNRD1 mRNA
  • Ethinyl Estradiol results in increased expression of TXNRD1 mRNA
16174780
fulvestrant
  • fulvestrant results in decreased expression of TXNRD1 mRNA
16514628
gedunin
  • gedunin results in increased expression of TXNRD1 mRNA
17010675
glycidamide
  • glycidamide results in increased expression of TXNRD1 mRNA
17822822
Gold
  • Gold results in decreased activity of TXNRD1 protein
16510263
Gold Compounds
  • Gold Compounds results in decreased activity of TXNRD1 protein
16510263
Gold Sodium Thiomalate
  • Gold Sodium Thiomalate results in decreased activity of TXNRD1 protein
16510263
Gold Sodium Thiomalate
  • Gold Sodium Thiomalate inhibits the reaction [TXNRD1 protein affects the metabolism of Dithionitrobenzoic Acid]
17229725
Hydrogen Peroxide
  • Hydrogen Peroxide results in increased expression of TXNRD1 mRNA
15521073, 12414654
Hydrogen Peroxide
  • Hydrogen Peroxide results in increased expression of TXNRD1 mRNA
15521073
hydroquinone
  • hydroquinone results in increased expression of TXNRD1 mRNA
15452088
hydroxyhydroquinone
  • hydroxyhydroquinone results in increased expression of TXNRD1 mRNA
17572062
Isoflavones
  • Isoflavones results in increased expression of TXNRD1 mRNA
17374662
Mercury
  • Mercury results in increased expression of TXNRD1 mRNA
17547211
Methapyrilene
  • Methapyrilene results in increased expression of TXNRD1 mRNA
16393664
methylformamide
  • methylformamide affects the expression of TXNRD1 mRNA
  • methylformamide analog affects the expression of TXNRD1 mRNA
17040096
methylmercury II
  • methylmercury II results in increased expression of TXNRD1 mRNA
17905399
methylselenic acid
  • TXNRD1 protein results in increased metabolism of methylselenic acid
  • methylselenic acid does not affect the activity of TXNRD1 protein
  • TXNRD1 protein results in increased metabolism of methylselenic acid
  • methylselenic acid does not affect the activity of TXNRD1 protein
11782468
Metribolone
  • Metribolone results in decreased expression of TXNRD1 protein
17152098
N(6)-(delta(2)-isopentenyl)adenine
  • N(6)-(delta(2)-isopentenyl)adenine results in increased expression of TXNRD1 mRNA
16129123
nickel chloride
  • nickel chloride results in increased expression of TXNRD1 mRNA
17547211
nitrosobenzylmethylamine
  • nitrosobenzylmethylamine results in increased expression of TXNRD1 mRNA
17616710
Paraquat
  • Paraquat affects the expression of TXNRD1 mRNA
16854511
Paraquat
  • Paraquat results in increased expression of TXNRD1 mRNA
12954614
Paraquat
  • Paraquat results in decreased activity of TXNRD1 protein
  • Selenium inhibits the reaction [Paraquat results in decreased activity of TXNRD1 protein]
17055214
Paraquat
  • Paraquat results in increased activity of TXNRD1 protein
  • diphenyleneiodonium inhibits the reaction [Paraquat results in increased activity of TXNRD1 protein]
17229725
perfluorooctane sulfonic acid
  • perfluorooctane sulfonic acid affects the expression of TXNRD1 mRNA
17383973
phenethyl isothiocyanate
  • phenethyl isothiocyanate results in increased expression of TXNRD1 mRNA
17616710
Phenol
  • Phenol results in increased expression of TXNRD1 mRNA
17547211
Raloxifene
  • Raloxifene results in decreased expression of TXNRD1 mRNA
16514628
resveratrol
  • resveratrol does not affect the expression of TXNRD1 mRNA
  • resveratrol results in increased activity of TXNRD1 protein
17261084
Selenium
  • Selenium inhibits the reaction [Paraquat results in decreased activity of TXNRD1 protein]
  • Selenium results in increased activity of TXNRD1 protein
17055214
sodium arsenate
  • sodium arsenate results in increased expression of TXNRD1 mRNA
16882884
sodium arsenate
  • sodium arsenate results in increased expression of TXNRD1 mRNA
12727804
sodium arsenite
  • sodium arsenite results in increased expression of TXNRD1 mRNA
15521073
sodium arsenite
  • sodium arsenite results in increased expression of TXNRD1 mRNA
15521073, 12679051, 12377979, 12760830
sodium arsenite
  • sodium arsenite results in increased expression of TXNRD1 mRNA
16014739
Sodium Selenite
  • Sodium Selenite inhibits the reaction [cholestane-3,5,6-triol results in increased expression of TXNRD1 mRNA]
16039982
Sodium Selenite
  • Buthionine Sulfoximine promotes the reaction [Sodium Selenite results in increased activity of TXNRD1 protein]
  • Sodium Selenite does not affect the expression of TXNRD1 mRNA
  • Sodium Selenite promotes the reaction [sulforafan results in increased activity of TXNRD1 protein]
  • Sodium Selenite promotes the reaction [sulforafan results in increased expression of TXNRD1 mRNA]
  • Sodium Selenite promotes the reaction [sulforafan results in increased expression of TXNRD1 protein]
  • Sodium Selenite results in increased activity of TXNRD1 protein
  • Sodium Selenite results in increased expression of TXNRD1 protein
12663510
Sodium Selenite
  • Sodium Selenite results in increased activity of TXNRD1 protein
18215477
sulforafan
  • 1-(5-isoquinolinylsulfonyl)-3-methylpiperazine inhibits the reaction [sulforafan results in increased expression of TXNRD1 mRNA]
  • Buthionine Sulfoximine inhibits the reaction [sulforafan results in increased expression of TXNRD1 mRNA]
  • Cycloheximide inhibits the reaction [sulforafan results in increased expression of TXNRD1 mRNA]
  • Dactinomycin inhibits the reaction [sulforafan results in increased expression of TXNRD1 mRNA]
  • Sodium Selenite promotes the reaction [sulforafan results in increased activity of TXNRD1 protein]
  • Sodium Selenite promotes the reaction [sulforafan results in increased expression of TXNRD1 mRNA]
  • Sodium Selenite promotes the reaction [sulforafan results in increased expression of TXNRD1 protein]
  • sulforafan results in increased activity of TXNRD1 protein
  • sulforafan results in increased expression of TXNRD1 mRNA
  • sulforafan results in increased expression of TXNRD1 protein
12663510
systhane
  • systhane affects the expression of TXNRD1 mRNA
17383973
Tamoxifen
  • Tamoxifen affects the expression of TXNRD1 mRNA
17555576
tert-Butylhydroperoxide
  • tert-Butylhydroperoxide results in increased expression of TXNRD1 mRNA
16636651, 12414654
tert-Butylhydroperoxide
  • MT2A protein promotes the reaction [tert-Butylhydroperoxide results in increased expression of TXNRD1 mRNA]
16636651
Tetrachlorodibenzodioxin
  • Tetrachlorodibenzodioxin results in increased expression of TXNRD1 mRNA
16960034, 16054898
Tetrachlorodibenzodioxin
  • Tetrachlorodibenzodioxin results in increased expression of TXNRD1 mRNA
16960034
Tetracycline
  • Tetracycline results in decreased expression of TXNRD1 mRNA
17522070
Thioacetamide
  • Thioacetamide results in increased activity of TXNRD1 protein
18215477
triadimefon
  • triadimefon affects the expression of TXNRD1 mRNA
17383973
triphenylphosphine gold chloride
  • triphenylphosphine gold chloride results in decreased activity of TXNRD1 protein
16510263
tripterine
  • tripterine results in increased expression of TXNRD1 mRNA
17010675
Vitamin K 3
  • Vitamin K 3 results in increased expression of TXNRD1 mRNA
12414654
Zinc
  • Zinc inhibits the reaction [Edetic Acid results in increased activity of TXNRD1 protein]
16774913

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Acrodermatitis inferred via Zinc 17190629, 16889938, 17202136
Alzheimer Disease inferred via Zinc 17119284, 16325427, 16580781, 16410023
Anemia, Sickle Cell inferred via Zinc 16916123
Asthma inferred via Zinc 17085522
Brain Injuries inferred via Zinc 17109824
Carcinoma, Squamous Cell inferred via Zinc 16543248
Cardiovascular Diseases inferred via Zinc 16936243
Diabetes Mellitus inferred via Zinc 16479319
Esophageal Neoplasms inferred via Zinc 16543248
Gastritis inferred via Zinc 17241300
Growth Disorders inferred via Zinc 17217573
Heart Failure inferred via Zinc 17162251
Heart Injuries inferred via Zinc 17074742
Helicobacter Infections inferred via Zinc 17241300
Hepatolenticular Degeneration inferred via Zinc 17276780
Ischemia inferred via Zinc 16584753
Kidney Diseases inferred via Zinc 16960431
Kidney Failure, Chronic inferred via Zinc 16518626
Mammary Neoplasms, Experimental inferred via Zinc 12773700
Pre-Eclampsia inferred via Zinc 17114810
Prostatic Neoplasms inferred via Zinc 12429649, 16700911, 16606632, 16517595
Retinal Degeneration inferred via Zinc 16584753
Tongue Neoplasms inferred via Zinc 16543248
Cleft Palate inferred via triadimefon 16781842
Craniofacial Abnormalities inferred via triadimefon 16875885
Liver Cirrhosis, Experimental inferred via Thioacetamide 16248980, 18395095, 16097051, 18295389
Fatty Liver inferred via Tetracycline 16917069
Hepatitis, Toxic inferred via Tetracycline 17522070
Nephritis, Interstitial inferred via Tetracycline 9884423
Pemphigoid, Bullous inferred via Tetracycline 11026799
Prion Diseases inferred via Tetracycline 10903871
Adenoma, Liver Cell inferred via Tetrachlorodibenzodioxin 16835633
Carcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cholangiocarcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cleft Palate inferred via Tetrachlorodibenzodioxin 8697196
Diabetes Mellitus, Type 2 inferred via Tetrachlorodibenzodioxin 17107852
Hydronephrosis inferred via Tetrachlorodibenzodioxin 8697196
Liver Neoplasms inferred via Tetrachlorodibenzodioxin 16984957
Breast Neoplasms inferred via Tamoxifen 16202921, 17242785, 11161223, 17049068, 17893378, 15668708, 17440819, 17261762, 16873071, 16818667, 15565566
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 14580682, 16827153
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Adenomatous Polyposis Coli inferred via sulforafan 17942926
Diabetes Mellitus inferred via Sodium Selenite 16285004
Lymphoma, B-Cell inferred via Sodium Selenite 14737004
Adrenal Gland Neoplasms inferred via sodium arsenite 15276417
Adrenocortical Adenoma inferred via sodium arsenite 16712894
Carcinoma, Hepatocellular inferred via sodium arsenite 15276417, 16507464
Carcinoma, Squamous Cell inferred via sodium arsenite 18572023
Genital Neoplasms, Female inferred via sodium arsenite 16452187
Hodgkin Disease inferred via sodium arsenite 12676792
Liver Neoplasms inferred via sodium arsenite 15276417, 16712894
Lung Neoplasms inferred via sodium arsenite 15276417, 17077188, 16712894
Melanoma inferred via sodium arsenite 16487513
Neoplasms inferred via sodium arsenite 11559025
Neural Tube Defects inferred via sodium arsenite 12854658
Ovarian Neoplasms inferred via sodium arsenite 15276417
Prostatic Neoplasms inferred via sodium arsenite 16039940
Skin Neoplasms inferred via sodium arsenite 18572023
Spinal Dysraphism inferred via sodium arsenite 12854658
Urinary Bladder Neoplasms inferred via sodium arsenite 11723127, 16712894, 16452187
Uterine Cervical Neoplasms inferred via sodium arsenite 11813266
Vascular Diseases inferred via sodium arsenite 17056641
Neural Tube Defects inferred via sodium arsenate 11749123
Heart Failure inferred via Selenium 17162251
Influenza, Human inferred via Selenium 16624496
Kidney Failure, Chronic inferred via Selenium 16518626
Adenoma inferred via resveratrol 15688382
Alzheimer Disease inferred via resveratrol 16183991, 16162502
Arthritis, Experimental inferred via resveratrol 17115116
Atherosclerosis inferred via resveratrol 16873680, 17967414
Brain Ischemia inferred via resveratrol 17600658
Breast Neoplasms inferred via resveratrol 17651959, 17534123, 16393696
Carcinoma, Hepatocellular inferred via resveratrol 16227395
Carcinoma, Lewis Lung inferred via resveratrol 16675471
Carcinoma, Squamous Cell inferred via resveratrol 16227395
Cardiovascular Diseases inferred via resveratrol 15458977
Colitis inferred via resveratrol 16474422
Colonic Neoplasms inferred via resveratrol 16338953
Colorectal Neoplasms inferred via resveratrol 16550006
Diabetes Mellitus, Experimental inferred via resveratrol 16873680
Diabetic Nephropathies inferred via resveratrol 16286809
Edema inferred via resveratrol 8985016
Encephalomyelitis, Autoimmune, Experimental inferred via resveratrol 17872969
Enterocolitis, Necrotizing inferred via resveratrol 17923197
Herpes Simplex inferred via resveratrol 16876885
Hypercholesterolemia inferred via resveratrol 17188708
Hyperlipidemias inferred via resveratrol 16873680
Hypertrophy, Left Ventricular inferred via resveratrol 17488730
Infarction, Middle Cerebral Artery inferred via resveratrol 17600658
Inflammation inferred via resveratrol 16366677
Influenza, Human inferred via resveratrol 16624496
Kidney Failure, Acute inferred via resveratrol 16538975
Leukemia, Promyelocytic, Acute inferred via resveratrol 16087638
Lymphoma, B-Cell inferred via resveratrol 17088997
Lymphoma, Non-Hodgkin inferred via resveratrol 14749477
Mammary Neoplasms, Animal inferred via resveratrol 15688416
Mammary Neoplasms, Experimental inferred via resveratrol 8985016, 11606380
Melanoma inferred via resveratrol 17992120
Metabolic Diseases inferred via resveratrol 17112576
Multiple Myeloma inferred via resveratrol 14749477, 16267019, 16490592, 17935668, 17164350, 17049120
Muscular Atrophy, Spinal inferred via resveratrol 17962980
Myocardial Infarction inferred via resveratrol 17188708, 17125593, 17015251, 16456233, 16317513, 16525036
Myocardial Ischemia inferred via resveratrol 17125593, 17015251
Myocarditis inferred via resveratrol 17322642
Neoplasms, Experimental inferred via resveratrol 8985016
Neurodegenerative Diseases inferred via resveratrol 17652729
Neurogenic Inflammation inferred via resveratrol 17929310
Osteoporosis, Postmenopausal inferred via resveratrol 17513867
Prenatal Exposure Delayed Effects inferred via resveratrol 16679765
Prostatic Neoplasms inferred via resveratrol 17675339, 15767336, 17718901, 17636462, 17804756, 16731767
Renal Insufficiency, Chronic inferred via resveratrol 16325855
Reperfusion Injury inferred via resveratrol 17058453, 17520802, 16314181, 15827377, 16317513
Skin Neoplasms inferred via resveratrol 15837718, 8985016
STROKE, ISCHEMIC inferred via resveratrol 16321402
Tongue Neoplasms inferred via resveratrol 16227395
Uterine Cervical Neoplasms inferred via resveratrol 17473185
Uterine Neoplasms inferred via resveratrol 17044934
Ventricular Dysfunction, Left inferred via resveratrol 17488730
Albuminuria inferred via Raloxifene 17308373, 17451421
Alzheimer Disease inferred via Raloxifene 15800139
Brain Injuries inferred via Raloxifene 16580743
Breast Neoplasms inferred via Raloxifene 17242785, 17893378, 16912660, 15775269, 17440819, 16837676, 17595753, 17049068, 17261762, 17952589, 15758505, 15572757
Carcinoma, Transitional Cell inferred via Raloxifene 17572228
Cardiovascular Diseases inferred via Raloxifene 15775269
Cognition Disorders inferred via Raloxifene 15800139
Depressive Disorder, Major inferred via Raloxifene 17474826
Diabetic Nephropathies inferred via Raloxifene 17308373, 17451421, 15920148
Edema inferred via Raloxifene 15860553
Encephalomyelitis, Autoimmune, Experimental inferred via Raloxifene 15845917
Fatty Liver inferred via Raloxifene 17473493
Heart Diseases inferred via Raloxifene 11110106
Hypertension inferred via Raloxifene 15787275, 17577099
Leiomyoma inferred via Raloxifene 16973256
Mixed Tumor, Mullerian inferred via Raloxifene 15863610
Multiple Myeloma inferred via Raloxifene 16497877
Myxoma inferred via Raloxifene 16343187
Osteoporosis inferred via Raloxifene 15775268, 17882678
Osteoporosis, Postmenopausal inferred via Raloxifene 15758505, 17893378, 15579764, 17823083
Prostatic Neoplasms inferred via Raloxifene 16220300, 16536755, 15731164
Purpura inferred via Raloxifene 15770314
Stroke inferred via Raloxifene 16837676
Urinary Bladder Neoplasms inferred via Raloxifene 17572228
Venous Thromboembolism inferred via Raloxifene 16837676
Vulvar Neoplasms inferred via Raloxifene 16343187
Testicular Diseases inferred via phenethyl isothiocyanate 15864552
Glioblastoma inferred via perfluorooctane sulfonic acid 17162496
Agricultural Workers' Diseases inferred via Paraquat 11874814
Gliosis inferred via Paraquat 11124998
Nerve Degeneration inferred via Paraquat 16893418
Parkinson Disease inferred via Paraquat 12911755, 11445065, 16510128, 15451049, 11124998, 16140633, 15824117, 11181820
Pneumonia inferred via Paraquat 12504350
Pulmonary Fibrosis inferred via Paraquat 16324872, 17997886
Respiratory Distress Syndrome, Adult inferred via Paraquat 11700416
Respiratory Sounds inferred via Paraquat 11874814
Retinal Degeneration inferred via Paraquat 16458197
Esophageal Neoplasms inferred via nitrosobenzylmethylamine 16805852, 15547721, 15623463, 15150132, 15264214, 16704527, 15547733, 15878914, 16510608
Stomach Neoplasms inferred via nitrosobenzylmethylamine 17575124, 12958204
Liver Neoplasms inferred via Methapyrilene 15890375
Autoimmune Diseases inferred via Mercury 16634805
Cardiovascular Diseases inferred via Isoflavones 17689850
Colorectal Neoplasms inferred via Isoflavones 17116718
Hot Flashes inferred via Isoflavones 17290160
Osteoporosis inferred via Isoflavones 16562857
Prostatic Neoplasms inferred via Isoflavones 16365062, 17571952, 17219775, 17374662
Cardiovascular Diseases inferred via Hydrogen Peroxide 16936243
Kidney Failure, Chronic inferred via Hydrogen Peroxide 16518626
Arthritis inferred via Gold Compounds 16791640
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16919318, 17681005, 16105132, 11677210, 15861022, 17333356
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Breast Neoplasms inferred via Estradiol 17289903, 12948864, 17261762, 14630087, 18497071, 17018787
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 11408345, 16891317, 11807958
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Hepatitis, Toxic inferred via Erythromycin Estolate 17522070
Leukemia-Lymphoma, Adult T-Cell inferred via Emodin 17077332
Dermatitis, Allergic Contact inferred via Dinitrochlorobenzene 15491423
Melanoma inferred via Dinitrochlorobenzene 17334785, 12202904
Adenocarcinoma inferred via Dimethylnitrosamine 16033868
Carcinoma, Squamous Cell inferred via Dimethylnitrosamine 16033868
Esophageal Neoplasms inferred via Dimethylnitrosamine 17016578
Liver Cirrhosis, Experimental inferred via Dimethylnitrosamine 17203207, 17465448, 17036385, 18210741, 17534399, 18095165, 15339415, 17432682, 17198567, 15086199, 15733078, 16009107, 18637143, 18672772, 15067225, 17640959, 18364076, 15369754, 15099470, 14709902, 15577212, 15504291, 17666798, 15138612, 16603200, 17724770, 15723089, 14726149, 16627068, 15942678, 15744066, 15591649, 18239293, 16270385, 17881167, 15492853, 18629640, 15864749, 15763062, 16544323, 15842777, 15793283, 18371158, 12925901, 15366600, 17348192, 17201889, 18237412, 17719030, 15081153, 16169303, 14643895, 18567088, 15798949, 15571005, 15161499, 12918455, 15298665, 16042886, 15479170, 17196135, 15383259, 14659978, 14568256, 16570917
Liver Failure, Acute inferred via Dimethylnitrosamine 17457977
Liver Neoplasms inferred via Dimethylnitrosamine 3113478, 15890375
Liver Neoplasms, Experimental inferred via Dimethylnitrosamine 15603536
Lung Neoplasms inferred via Dimethylnitrosamine 16061637
Stomach Neoplasms inferred via Dimethylnitrosamine 16033868
Bone Marrow Neoplasms inferred via Dactinomycin 14601052
Sarcoma, Ewing's inferred via Dactinomycin 14601052
Hepatitis, Toxic inferred via cyanoginosin LR 17654400
Hepatitis, Toxic inferred via Chloroform 3104120, 17522070
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 15700767, 16124888, 16227642, 10355542, 15673190, 16097048, 16011737, 16050911
Fatty Liver inferred via Carbon Tetrachloride 16045604, 15959796, 12795759, 12631006, 17595544, 16239168, 61145
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 15968718, 15027814, 16227642, 15998439, 16177239, 11566570
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 17334410, 16943688, 16221502, 16239168
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 15925388, 16248980, 16116963, 17805973, 17976157, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12666154, 16638106, 18395095, 18156304, 17557913, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 17525996
Liver Diseases inferred via Carbon Tetrachloride 16246199, 17285989, 15720792, 16964402, 15830285
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Breast Neoplasms inferred via Calcitriol 11237771
Carcinoma, Squamous Cell inferred via Calcitriol 11237771
Encephalomyelitis, Autoimmune, Experimental inferred via Calcitriol 15138306
Prostatic Hyperplasia inferred via Calcitriol 15572423
Prostatic Neoplasms inferred via Calcitriol 12479363, 16289102, 16644109
Kidney Diseases inferred via Cadmium Chloride 16962696
Cell Transformation, Neoplastic inferred via Cadmium 17332340
Kidney Diseases inferred via Cadmium 16962696, 16322080
Prostatic Neoplasms inferred via Cadmium 17075824
Esophageal Neoplasms inferred via Benzo(a)pyrene 16530937
Lung Neoplasms inferred via Benzo(a)pyrene 17053015
Urinary Bladder Neoplasms inferred via Benzo(a)pyrene 17053015
Arthritis, Rheumatoid inferred via Auranofin 16510263
Rheumatic Diseases inferred via Auranofin 17034761
Colonic Neoplasms inferred via arsenite 15037631
Lung Neoplasms inferred via arsenite 16809336
Neovascularization, Pathologic inferred via arsenite 15738583
Leishmaniasis inferred via Antimony 15220340
Trypanosomiasis inferred via Antimony 15220340
Alzheimer Disease inferred via Acrolein 14715435, 17570602, 15207723
Arteriosclerosis inferred via Acrolein 15014928
Atherosclerosis inferred via Acrolein 17363696, 16037261, 16126721
Colorectal Neoplasms inferred via Acrolein 17597105
Kidney Diseases inferred via Acrolein 12488133
Kidney Failure inferred via Acrolein 12732208
Lung Diseases inferred via Acrolein 11504702
Melanoma, Experimental inferred via Acrolein 10803710
Neoplasms inferred via Acrolein 17329238
Nephritis inferred via Acrolein 12653641
Neurodegenerative Diseases inferred via Acrolein 11342003
Parkinson Disease inferred via Acrolein 17690948
Photosensitivity Disorders inferred via Acrolein 11550810
Stroke inferred via Acrolein 16269634
Carcinoma, Squamous Cell inferred via Acetylcysteine 17015178
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 15968718, 16227642, 16177239, 14986274, 17562736, 17522070
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215
Cholestasis, Intrahepatic inferred via 1-Naphthylisothiocyanate 10220858
Hepatitis, Toxic inferred via 1-Naphthylisothiocyanate 17522070
Liver Diseases inferred via 1-Naphthylisothiocyanate 17184895

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
GLRX2 TXNRD1 / GLRX2 Biochemical Activity Johansson C (2004)
POU2F1 POU2F1 / TXNRD1 Reconstituted Complex Kakizawa T (1999)
POU2F2 POU2F2 / TXNRD1 Reconstituted Complex Kakizawa T (1999)
PPP1R16A PPP1R16A / TXNRD1 Two-hybrid Stelzl U (2005)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Du Y, et al. (2009) "Inhibition of mammalian thioredoxin reductase by black tea and its constituents: implications for anticancer actions." Biochimie. 91(3):434-444. PMID:19059456
  2. [ + ] Mavaddat N, et al. (2009) "Common genetic variation in candidate genes and susceptibility to subtypes of breast cancer." Cancer Epidemiol Biomarkers Prev. 18(1):255-259. PMID:19124506
  3. [ + ] Mitchell J, et al. (2008) "Thioredoxin reductase 1 haplotypes modify familial amyotrophic lateral sclerosis onset." Free Radic Biol Med. ():. PMID:18996185
  4. [ + ] Starr JM, et al. (2008) "Oxidative stress, telomere length and biomarkers of physical aging in a cohort aged 79 years from the 1932 Scottish Mental Survey." Mech Ageing Dev. 129(12):745-751. PMID:18977241
  5. [ + ] Kalantari P, et al. (2008) "Thioredoxin reductase-1 negatively regulates HIV-1 transactivating protein Tat-dependent transcription in human macrophages." J Biol Chem. 283(48):33183-33190. PMID:18835810
  6. [ + ] Peters U, et al. (2008) "Variation in the selenoenzyme genes and risk of advanced distal colorectal adenoma." Cancer Epidemiol Biomarkers Prev. 17(5):1144-1154. PMID:18483336
  7. [ + ] Anestal K, et al. (2008) "Cell death by SecTRAPs: thioredoxin reductase as a prooxidant killer of cells." PLoS ONE. 3(4):e1846. PMID:18382651
  8. [ + ] Watson WH, et al. (2008) "Thioredoxin reductase-1 knock down does not result in thioredoxin-1 oxidation." Biochem Biophys Res Commun. 368(3):832-836. PMID:18267104
  9. [ + ] Kabuyama Y, et al. (2008) "Involvement of thioredoxin reductase 1 in the regulation of redox balance and viability of rheumatoid synovial cells." Biochem Biophys Res Commun. 367(2):491-496. PMID:18187038
  10. [ + ] Dammeyer P, et al. (2008) "Induction of cell membrane protrusions by the N-terminal glutaredoxin domain of a rare splice variant of human thioredoxin reductase 1." J Biol Chem. 283(5):2814-2821. PMID:18042542
  11. [ + ] Zou K, et al. (2008) "Identification of FMRP-associated mRNAs using yeast three-hybrid system." Am J Med Genet B Neuropsychiatr Genet. 147B(6):769-777. PMID:18163424
  12. [ + ] Wang Y, et al. (2008) "Inhibitory effect of green tea extract and (-)-epigallocatechin-3-gallate on mammalian thioredoxin reductase and HeLa cell viability." Oncol Rep. 20(6):1479-1487. PMID:19020731
  13. [ + ] Fritz-Wolf K, et al. (2007) "The structure of human thioredoxin reductase 1 provides insights into C-terminal rearrangements during catalysis." J Mol Biol. 370(1):116-127. PMID:17512005
  14. [ + ] Udler M, et al. (2007) "Common germline genetic variation in antioxidant defense genes and survival after diagnosis of breast cancer." J Clin Oncol. 25(21):3015-3023. PMID:17634480
  15. [ + ] Harris SE, et al. (2007) "A genetic association analysis of cognitive ability and cognitive ageing using 325 markers for 109 genes associated with oxidative stress or cognition." BMC Genet. 8():43. PMID:17601350
  16. [ + ] Sohn KC, et al. (2007) "Effect of thioredoxin reductase 1 on glucocorticoid receptor activity in human outer root sheath cells." Biochem Biophys Res Commun. 356(3):810-815. PMID:17382897
  17. [ + ] Hashemy SI, et al. (2006) "Motexafin gadolinium, a tumor-selective drug targeting thioredoxin reductase and ribonucleotide reductase." J Biol Chem. 281(16):10691-10697. PMID:16481328
  18. [ + ] Gromer S, et al. (2006) "Mutational studies confirm the catalytic triad in the human selenoenzyme thioredoxin reductase predicted by molecular modeling." Chembiochem. 7(11):1649-1652. PMID:16977661
  19. [ + ] Oestergaard MZ, et al. (2006) "Interactions between genes involved in the antioxidant defence system and breast cancer risk." Br J Cancer. 95(4):525-531. PMID:16868544
  20. [ + ] Urig S, et al. (2006) "Truncated mutants of human thioredoxin reductase 1 do not exhibit glutathione reductase activity." FEBS Lett. 580(15):3595-3600. PMID:16750198
  21. [ + ] Cebrian A, et al. (2006) "Tagging single-nucleotide polymorphisms in antioxidant defense enzymes and susceptibility to breast cancer." Cancer Res. 66(2):1225-1233. PMID:16424062
  22. [ + ] Seemann S, et al. (2005) "Roles of thioredoxin reductase 1 and APE/Ref-1 in the control of basal p53 stability and activity." Oncogene. 24(24):3853-3863. PMID:15824742
  23. [ + ] Stelzl U, et al. (2005) "A human protein-protein interaction network: a resource for annotating the proteome." Cell. 122(6):957-968. PMID:16169070
  24. [ + ] Fang J, et al. (2005) "Thioredoxin reductase is irreversibly modified by curcumin: a novel molecular mechanism for its anticancer activity." J Biol Chem. 280(26):25284-25290. PMID:15879598
  25. [ + ] Rush J, et al. (2005) "Immunoaffinity profiling of tyrosine phosphorylation in cancer cells." Nat Biotechnol. 23(1):94-101. PMID:15592455
  26. [ + ] Rundlof AK, et al. (2004) "Evidence for intriguingly complex transcription of human thioredoxin reductase 1." Free Radic Biol Med. 36(5):641-656. PMID:14980707
  27. [ + ] Jeong W, et al. (2004) "Identification and characterization of TRP14, a thioredoxin-related protein of 14 kDa. New insights into the specificity of thioredoxin function." J Biol Chem. 279(5):3142-3150. PMID:14607844
  28. [ + ] Johansson C, et al. (2004) "Human mitochondrial glutaredoxin reduces S-glutathionylated proteins with high affinity accepting electrons from either glutathione or thioredoxin reductase." J Biol Chem. 279(9):7537-7543. PMID:14676218
  29. [ + ] Yu MK, et al. (2004) "Conditional expression of 15-lipoxygenase-1 inhibits the selenoenzyme thioredoxin reductase: modulation of selenoproteins by lipoxygenase enzymes." J Biol Chem. 279(27):28028-28035. PMID:15123685
  30. [ + ] Furman C, et al. (2004) "Thioredoxin reductase 1 is upregulated in atherosclerotic plaques: specific induction of the promoter in human macrophages by oxidized low-density lipoproteins." Free Radic Biol Med. 37(1):71-85. PMID:15183196
  31. [ + ] Damdimopoulos AE, et al. (2004) "An alternative splicing variant of the selenoprotein thioredoxin reductase is a modulator of estrogen signaling." J Biol Chem. 279(37):38721-38729. PMID:15199063
  32. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  33. [ + ] Lechner S, et al. (2003) "Thioredoxin reductase 1 expression in colon cancer: discrepancy between in vitro and in vivo findings." Lab Invest. 83(9):1321-1331. PMID:13679440
  34. [ + ] Xia L, et al. (2003) "The mammalian cytosolic selenoenzyme thioredoxin reductase reduces ubiquinone. A novel mechanism for defense against oxidative stress." J Biol Chem. 278(4):2141-2146. PMID:12435734
  35. [ + ] Mugesh G, et al. (2003) "Selenenyl iodide: a new substrate for mammalian thioredoxin reductase." Org Biomol Chem. 1(16):2848-2852. PMID:12968334
  36. [ + ] Hintze KJ, et al. (2003) "Thioredoxin reductase in human hepatoma cells is transcriptionally regulated by sulforaphane and other electrophiles via an antioxidant response element." J Nutr. 133(9):2721-2727. PMID:12949356
  37. [ + ] Ratts R, et al. (2003) "The cytosolic entry of diphtheria toxin catalytic domain requires a host cell cytosolic translocation factor complex." J Cell Biol. 160(7):1139-1150. PMID:12668662
  38. [ + ] Anestal K, et al. (2003) "Rapid induction of cell death by selenium-compromised thioredoxin reductase 1 but not by the fully active enzyme containing selenocysteine." J Biol Chem. 278(18):15966-15972. PMID:12574159
  39. [ + ] Gromer S, et al. (2002) "Methylseleninate is a substrate rather than an inhibitor of mammalian thioredoxin reductase. Implications for the antitumor effects of selenium." J Biol Chem. 277(12):9701-9706. PMID:11782468
  40. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  41. [ + ] Karimpour S, et al. (2002) "Thioredoxin reductase regulates AP-1 activity as well as thioredoxin nuclear localization via active cysteines in response to ionizing radiation." Oncogene. 21(41):6317-6327. PMID:12214272
  42. [ + ] Ma X, et al. (2002) "Mutational analysis of human thioredoxin reductase 1. Effects on p53-mediated gene expression and interferon and retinoic acid-induced cell death." J Biol Chem. 277(25):22460-22468. PMID:11953436
  43. [ + ] Osborne SA, et al. (2001) "Genomic organisation and alternative splicing of mouse and human thioredoxin reductase 1 genes." BMC Genomics. 2(1):10. PMID:11737861
  44. [ + ] Lewin MH, et al. (2001) "Thioredoxin reductase and cytoplasmic glutathione peroxidase activity in human foetal and neonatal liver." Biochim Biophys Acta. 1526(3):237-241. PMID:11410332
  45. [ + ] Rundlof AK, et al. (2001) "The core promoter of human thioredoxin reductase 1: cloning, transcriptional activity, and Oct-1, Sp1, and Sp3 binding reveal a housekeeping-type promoter for the AU-rich element-regulated gene." J Biol Chem. 276(32):30542-30551. PMID:11375392
  46. [ + ] Soderberg A, et al. (2000) "Thioredoxin reductase, a redox-active selenoprotein, is secreted by normal and neoplastic cells: presence in human plasma." Cancer Res. 60(8):2281-2289. PMID:10786696
  47. [ + ] Kakizawa T, et al. (1999) "Functional interaction between Oct-1 and retinoid X receptor." J Biol Chem. 274(27):19103-19108. PMID:10383413
  48. [ + ] Anema SM, et al. (1999) "Thioredoxin reductase is the major selenoprotein expressed in human umbilical-vein endothelial cells and is regulated by protein kinase C." Biochem J. 342 ( Pt 1)():111-117. PMID:10432307
  49. [ + ] Hofmann ER, et al. (1998) "Thioredoxin reductase mediates cell death effects of the combination of beta interferon and retinoic acid." Mol Cell Biol. 18(11):6493-6504. PMID:9774665
  50. [ + ] Gorlatov SN, et al. (1998) "Human thioredoxin reductase from HeLa cells: selective alkylation of selenocysteine in the protein inhibits enzyme activity and reduction with NADPH influences affinity to heparin." Proc Natl Acad Sci U S A. 95(15):8520-8525. PMID:9671710