2610028A01Rik | GeneID:72400 | Mus musculus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 72400 | Official Symbol | 2610028A01Rik |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | 2210403I16Rik; 67-11-3; AU024023; LPTS; LPTS1; MGC144540; Pinx1 | ||
| Full Name | RIKEN cDNA 2610028A01 gene | ||
| Description | RIKEN cDNA 2610028A01 gene | ||
| Chromosome | 14 C3 | ||
| Also Known As | PIN2-interacting protein X1; PIN2/TRF1-interacting protein; TRF1-interacting protein 1; liver-related putative tumor suppressor | ||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 31531
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:37330 | CG11180 | NP_611495.1 | Drosophila melanogaster |
| GeneID:54984 | PINX1 | NP_060354.4 | Homo sapiens |
| GeneID:72400 | 2610028A01Rik | NP_082504.1 | Mus musculus |
| GeneID:174456 | T23G7.3 | NP_495955.1 | Caenorhabditis elegans |
| GeneID:305963 | Pinx1 | XP_224282.3 | Rattus norvegicus |
| GeneID:368253 | pinx1 | NP_001013283.2 | Danio rerio |
| GeneID:422028 | PINX1 | XP_420036.2 | Gallus gallus |
| GeneID:463987 | LOC463987 | XP_519603.2 | Pan troglodytes |
| GeneID:525027 | PINX1 | NP_001029725.1 | Bos taurus |
| GeneID:607910 | LOC607910 | XP_849859.1 | Canis lupus familiaris |
| GeneID:853197 | PXR1 | NP_011796.1 | Saccharomyces cerevisiae |
| GeneID:1279919 | AgaP_AGAP008951 | XP_319704.2 | Anopheles gambiae |
| GeneID:2680202 | MGG_09279 | XP_364434.1 | Magnaporthe grisea |
| GeneID:2713711 | NCU02528.1 | XP_331727.1 | Neurospora crassa |
| GeneID:2892366 | KLLA0C14135g | XP_452832.1 | Kluyveromyces lactis |
| GeneID:4622610 | AGOS_AGL350C | NP_986317.1 | Eremothecium gossypii |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | abcam | ab2344 | PINX1 antibody (ab2344); Goat polyclonal to PINX1 |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005694 | Component | chromosome |
| GO:0000781 | Component | chromosome, telomeric region |
| GO:0005622 | Component | intracellular |
| GO:0005730 | Component | nucleolus |
| GO:0005634 | Component | nucleus |
| GO:0003676 | Function | nucleic acid binding |
| GO:0005515 | Function | protein binding |
| GO:0007049 | Process | cell cycle |
| GO:0045786 | Process | negative regulation of cell cycle |
| GO:0007004 | Process | telomere maintenance via telomerase |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSMUST00000022528 | MI0004998 | gga-miR-460 | CCUGCAUUGUACACACUGUGUG |
| ENSMUST00000022528 | MI0000780 | hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU |
| ENSMUST00000022528 | MI0001446 | hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA |
| ENSMUST00000022528 | MI0003131 | hsa-miR-492 | AGGACCUGCGGGACAAGAUUCUU |
| ENSMUST00000022528 | MI0003167 | hsa-miR-516b | AUCUGGAGGUAAGAAGCACUUU |
| ENSMUST00000022528 | MI0003172 | hsa-miR-516b | AUCUGGAGGUAAGAAGCACUUU |
| ENSMUST00000022528 | MI0003557 | hsa-miR-552 | AACAGGUGACUGGUUAGACAA |
| ENSMUST00000022528 | MI0003583 | hsa-miR-576-3p | AAGAUGUGGAAAAAUUGGAAUC |
| ENSMUST00000022528 | MI0003607 | hsa-miR-595 | GAAGUGUGCCGUGGUGUGUCU |
| ENSMUST00000022528 | MI0003620 | hsa-miR-607 | GUUCAAAUCCAGAUCUAUAAC |
| ENSMUST00000022528 | MI0003636 | hsa-miR-622 | ACAGUCUGCUGAGGUUGGAGC |
| ENSMUST00000022528 | MI0003639 | hsa-miR-625 | AGGGGGAAAGUUCUAUAGUCC |
| ENSMUST00000022528 | MI0003642 | hsa-miR-628-5p | AUGCUGACAUAUUUACUAGAGG |
| ENSMUST00000022528 | MI0003645 | hsa-miR-631 | AGACCUGGCCCAGACCUCAGC |
| ENSMUST00000022528 | MI0003652 | hsa-miR-637 | ACUGGGGGCUUUCGGGCUCUGCGU |
| ENSMUST00000022528 | MI0003663 | hsa-miR-648 | AAGUGUGCAGGGCACUGGU |
| ENSMUST00000022528 | MI0003664 | hsa-miR-649 | AAACCUGUGUUGUUCAAGAGUC |
| ENSMUST00000022528 | MI0003669 | hsa-miR-661 | UGCCUGGGUCUCUGGCCUGCGCGU |
| ENSMUST00000022528 | MI0000558 | mmu-let-7b | UGAGGUAGUAGGUUGUGUGGUU |
| ENSMUST00000022528 | MI0000137 | mmu-let-7g | UGAGGUAGUAGUUUGUACAGUU |
| ENSMUST00000022528 | MI0000138 | mmu-let-7i | UGAGGUAGUAGUUUGUGCUGUU |
| ENSMUST00000022528 | MI0000139 | mmu-miR-1 | UGGAAUGUAAAGAAGUAUGUAU |
| ENSMUST00000022528 | MI0000652 | mmu-miR-1 | UGGAAUGUAAAGAAGUAUGUAU |
| ENSMUST00000022528 | MI0000256 | mmu-miR-122 | UGGAGUGUGACAAUGGUGUUUG |
| ENSMUST00000022528 | MI0000152 | mmu-miR-125b* | ACAAGUCAGGUUCUUGGGACCU |
| ENSMUST00000022528 | MI0000165 | mmu-miR-140 | CAGUGGUUUUACCCUAUGGUAG |
| ENSMUST00000022528 | MI0000169 | mmu-miR-145 | GUCCAGUUUUCCCAGGAAUCCCU |
| ENSMUST00000022528 | MI0000564 | mmu-miR-15a | UAGCAGCACAUAAUGGUUUGUG |
| ENSMUST00000022528 | MI0000140 | mmu-miR-15b | UAGCAGCACAUCAUGGUUUACA |
| ENSMUST00000022528 | MI0000565 | mmu-miR-16 | UAGCAGCACGUAAAUAUUGGCG |
| ENSMUST00000022528 | MI0000566 | mmu-miR-16 | UAGCAGCACGUAAAUAUUGGCG |
| ENSMUST00000022528 | MI0000687 | mmu-miR-17* | ACUGCAGUGAGGGCACUUGUAG |
| ENSMUST00000022528 | MI0000223 | mmu-miR-181a | AACAUUCAACGCUGUCGGUGAGU |
| ENSMUST00000022528 | MI0000697 | mmu-miR-181a | AACAUUCAACGCUGUCGGUGAGU |
| ENSMUST00000022528 | MI0000723 | mmu-miR-181b | AACAUUCAUUGCUGUCGGUGGGU |
| ENSMUST00000022528 | MI0000823 | mmu-miR-181b | AACAUUCAUUGCUGUCGGUGGGU |
| ENSMUST00000022528 | MI0000724 | mmu-miR-181c | AACAUUCAACCUGUCGGUGAGU |
| ENSMUST00000022528 | MI0005450 | mmu-miR-181d | AACAUUCAUUGUUGUCGGUGGGU |
| ENSMUST00000022528 | MI0000553 | mmu-miR-196a* | UCGGCAACAAGAAACUGCCUGA |
| ENSMUST00000022528 | MI0000249 | mmu-miR-206 | UGGAAUGUAAGGAAGUGUGUGG |
| ENSMUST00000022528 | MI0003536 | mmu-miR-20b* | ACUGCAGUGUGAGCACUUCUAG |
| ENSMUST00000022528 | MI0000695 | mmu-miR-210 | CUGUGCGUGUGACAGCGGCUGA |
| ENSMUST00000022528 | MI0000570 | mmu-miR-22* | AGUUCUUCAGUGGCAAGCUUUA |
| ENSMUST00000022528 | MI0000703 | mmu-miR-223 | UGUCAGUUUGUCAAAUACCCCA |
| ENSMUST00000022528 | MI0000590 | mmu-miR-322 | CAGCAGCAAUUCAUGUUUUGGA |
| ENSMUST00000022528 | MI0000584 | mmu-miR-34a | UGGCAGUGUCUUAGCUGGUUGU |
| ENSMUST00000022528 | MI0001649 | mmu-miR-449a | UGGCAGUGUAUUGUUAGCUGGU |
| ENSMUST00000022528 | MI0004645 | mmu-miR-449c | AGGCAGUGCAUUGCUAGCUGG |
| ENSMUST00000022528 | MI0004636 | mmu-miR-497 | CAGCAGCACACUGUGGUUUGUA |
| ENSMUST00000022528 | MI0003519 | mmu-miR-543 | AAACAUUCGCGGUGCACUUCUU |
| ENSMUST00000022528 | MI0005518 | mmu-miR-574-5p | UGAGUGUGUGUGUGUGAGUGUGU |
| ENSMUST00000022528 | MI0005557 | mmu-miR-653 | GUGUUGAAACAAUCUCUACUG |
| ENSMUST00000022528 | MI0004123 | mmu-miR-675-5p | UGGUGCGGAAAGGGCCCACAGU |
| ENSMUST00000022528 | MI0004677 | mmu-miR-696 | GCGUGUGCUUGCUGUGGG |
| ENSMUST00000022528 | MI0004678 | mmu-miR-720 | AUCUCGCUGGGGCCUCCA |
| ENSMUST00000022528 | MI0004310 | mmu-miR-764-3p | AGGAGGCCAUAGUGGCAACUGU |
| ENSMUST00000022528 | MI0005471 | mmu-miR-871 | UAUUCAGAUUAGUGCCAGUCAUG |
| ENSMUST00000022528 | MI0000586 | mmu-miR-98 | UGAGGUAGUAAGUUGUAUUGUU |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] McKee AE, et al. (2005) "A genome-wide in situ hybridization map of RNA-binding proteins reveals anatomically restricted expression in the developing mouse brain." BMC Dev Biol. 5():14. PMID:16033648 - [
] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072 - [
] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073 - [
] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Liao C, et al. (2002) "[The cloning and expression of a novel mouse gene mLPTS and its subcellular localization]" Yi Chuan Xue Bao. 29(10):865-870. PMID:12561469 - [
] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851 - [
] Zhou XZ, et al. (2001) "The Pin2/TRF1-interacting protein PinX1 is a potent telomerase inhibitor." Cell. 107(3):347-359. PMID:11701125 - [
] Ko MS, et al. (2000) "Large-scale cDNA analysis reveals phased gene expression patterns during preimplantation mouse development." Development. 127(8):1737-1749. PMID:10725249 - [
] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159 - [
] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861 - [
] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
BACKGROUND: In eukaryotic cells, RNA-binding proteins (RBPs) contribute to gene expression by regulating the form, abundance, and stability of both coding and non-coding RNA. In the vertebrate brain, RBPs account for many distinctive features of RNA processing such as activity-dependent transcript localization and localized protein synthesis. Several RBPs with activities that are important for the proper function of adult brain have been identified, but how many RBPs exist and where these genes are expressed in the developing brain is uncharacterized. RESULTS: Here we describe a comprehensive catalogue of the unique RBPs encoded in the mouse genome and provide an online database of RBP expression in developing brain. We identified 380 putative RBPs in the mouse genome. Using in situ hybridization, we visualized the expression of 323 of these RBP genes in the brains of developing mice at embryonic day 13.5, when critical fate choice decisions are made and at P0, when major structural components of the adult brain are apparent. We demonstrate i) that 16 of the 323 RBPs examined show neural-specific expression at the stages we examined, and ii) that a far larger subset (221) shows regionally restricted expression in the brain. Of the regionally restricted RBPs, we describe one group that is preferentially expressed in the E13.5 ventricular areas and a second group that shows spatially restricted expression in post-mitotic regions of the embryonic brain. Additionally, we find a subset of RBPs that share the same complex pattern of expression, in proliferating regions of the embryonic and postnatal NS and peripheral tissues. CONCLUSION: Our data show that, in contrast to their proposed ubiquitous involvement in gene regulation, most RBPs are not uniformly expressed. Here we demonstrate the region-specific expression of RBPs in proliferating vs. post-mitotic brain regions as well as cell-type-specific RBP expression. We identify uncharacterized RBPs that exhibit neural-specific expression as well as novel RBPs that show expression in non-neural tissues. The data presented here and in an online database provide a visual filter for the functional analysis of individual RBPs.
This study describes comprehensive polling of transcription start and termination sites and analysis of previously unidentified full-length complementary DNAs derived from the mouse genome. We identify the 5' and 3' boundaries of 181,047 transcripts with extensive variation in transcripts arising from alternative promoter usage, splicing, and polyadenylation. There are 16,247 new mouse protein-coding transcripts, including 5154 encoding previously unidentified proteins. Genomic mapping of the transcriptome reveals transcriptional forests, with overlapping transcription on both strands, separated by deserts in which few transcripts are observed. The data provide a comprehensive platform for the comparative analysis of mammalian transcriptional regulation in differentiation and development.
Antisense transcription (transcription from the opposite strand to a protein-coding or sense strand) has been ascribed roles in gene regulation involving degradation of the corresponding sense transcripts (RNA interference), as well as gene silencing at the chromatin level. Global transcriptome analysis provides evidence that a large proportion of the genome can produce transcripts from both strands, and that antisense transcripts commonly link neighboring "genes" in complex loci into chains of linked transcriptional units. Expression profiling reveals frequent concordant regulation of sense/antisense pairs. We present experimental evidence that perturbation of an antisense RNA can alter the expression of sense messenger RNAs, suggesting that antisense transcription contributes to control of transcriptional outputs in mammals.
Only a small proportion of the mouse genome is transcribed into mature messenger RNA transcripts. There is an international collaborative effort to identify all full-length mRNA transcripts from the mouse, and to ensure that each is represented in a physical collection of clones. Here we report the manual annotation of 60,770 full-length mouse complementary DNA sequences. These are clustered into 33,409 'transcriptional units', contributing 90.1% of a newly established mouse transcriptome database. Of these transcriptional units, 4,258 are new protein-coding and 11,665 are new non-coding messages, indicating that non-coding RNA is a major component of the transcriptome. 41% of all transcriptional units showed evidence of alternative splicing. In protein-coding transcripts, 79% of splice variations altered the protein product. Whole-transcriptome analyses resulted in the identification of 2,431 sense-antisense pairs. The present work, completely supported by physical clones, provides the most comprehensive survey of a mammalian transcriptome so far, and is a valuable resource for functional genomics.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
A novel mouse gene mLPTS was cloned by EST assembling, RT-PCR and DNA sequencing. The gene fragment for mLPTS is 1244 bp in length, encoding a protein of 332 amino acids. The amino acid sequence of mLPTS has 78% homologue with that of LPTS gene, which is a novel liver cancer-related gene identified through positional candidate cloning stratage by our laboratory. The expression of LPTS gene was ubiquitous in normal human tissues, whereas levels appeared to be significantly reduced, or sometime undetectable in HCC cells and neoplastic tissues, and it might be involved in the negative regulation of cell proliferation. The expression of mLPTS gene was found in all mouse tissues analyzed, same with that of LPTS gene in human. There was only one transcript for mLPTS gene in mouse tissues. The phylogenetic tree was constructed through the amino acids sequence analysis and the study of the sequence homologue among different species. Next, mLPTS gene was cloned into green fluorescent protein eukarytic expression vector and then transfected into CHO cell line. The green fluorescent was mostly limited in the nucleolus, showing that the gene products of mLPTS in eukaryocytes were located in the nucleolus.
The RIKEN Mouse Gene Encyclopaedia Project, a systematic approach to determining the full coding potential of the mouse genome, involves collection and sequencing of full-length complementary DNAs and physical mapping of the corresponding genes to the mouse genome. We organized an international functional annotation meeting (FANTOM) to annotate the first 21,076 cDNAs to be analysed in this project. Here we describe the first RIKEN clone collection, which is one of the largest described for any organism. Analysis of these cDNAs extends known gene families and identifies new ones.
Telomerase activity is critical for normal and transformed human cells to escape from crisis and is implicated in oncogenesis. Here we describe a novel Pin2/TRF1 binding protein, PinX1 that inhibits telomerase activity and affects tumorigenicity. PinX1 and its small TID domain bind the telomerase catalytic subunit hTERT and potently inhibit its activity. Overexpression of PinX1 or its TID domain inhibits telomerase activity, shortens telomeres, and induces crisis, whereas depletion of endogenous PinX1 increases telomerase activity and elongates telomeres. Depletion of PinX1 also increases tumorigenicity in nude mice, consistent with its chromosome localization at 8p23, a region with frequent loss of heterozygosity in a number of human cancers. Thus, PinX1 is a potent telomerase inhibitor and a putative tumor suppressor.
Little is known about gene action in the preimplantation events that initiate mammalian development. Based on cDNA collections made from each stage from egg to blastocyst, 25438 3'-ESTs were derived, and represent 9718 genes, half of them novel. Thus, a considerable fraction of mammalian genes is dedicated to embryonic expression. This study reveals profound changes in gene expression that include the transient induction of transcripts at each stage. These results raise the possibility that development is driven by the action of a series of stage-specific expressed genes. The new genes, 798 of them placed on the mouse genetic map, provide entry points for analyses of human and mouse developmental disorders.
In the effort to prepare the mouse full-length cDNA encyclopedia, we previously developed several techniques to prepare and select full-length cDNAs. To increase the number of different cDNAs, we introduce here a strategy to prepare normalized and subtracted cDNA libraries in a single step. The method is based on hybridization of the first-strand, full-length cDNA with several RNA drivers, including starting mRNA as the normalizing driver and run-off transcripts from minilibraries containing highly expressed genes, rearrayed clones, and previously sequenced cDNAs as subtracting drivers. Our method keeps the proportion of full-length cDNAs in the subtracted/normalized library high. Moreover, our method dramatically enhances the discovery of new genes as compared to results obtained by using standard, full-length cDNA libraries. This procedure can be extended to the preparation of full-length cDNA encyclopedias from other organisms.
The RIKEN high-throughput 384-format sequencing pipeline (RISA system) including a 384-multicapillary sequencer (the so-called RISA sequencer) was developed for the RIKEN mouse encyclopedia project. The RISA system consists of colony picking, template preparation, sequencing reaction, and the sequencing process. A novel high-throughput 384-format capillary sequencer system (RISA sequencer system) was developed for the sequencing process. This system consists of a 384-multicapillary auto sequencer (RISA sequencer), a 384-multicapillary array assembler (CAS), and a 384-multicapillary casting device. The RISA sequencer can simultaneously analyze 384 independent sequencing products. The optical system is a scanning system chosen after careful comparison with an image detection system for the simultaneous detection of the 384-capillary array. This scanning system can be used with any fluorescent-labeled sequencing reaction (chain termination reaction), including transcriptional sequencing based on RNA polymerase, which was originally developed by us, and cycle sequencing based on thermostable DNA polymerase. For long-read sequencing, 380 out of 384 sequences (99.2%) were successfully analyzed and the average read length, with more than 99% accuracy, was 654.4 bp. A single RISA sequencer can analyze 216 kb with >99% accuracy in 2.7 h (90 kb/h). For short-read sequencing to cluster the 3' end and 5' end sequencing by reading 350 bp, 384 samples can be analyzed in 1.5 h. We have also developed a RISA inoculator, RISA filtrator and densitometer, RISA plasmid preparator which can handle throughput of 40,000 samples in 17.5 h, and a high-throughput RISA thermal cycler which has four 384-well sites. The combination of these technologies allowed us to construct the RISA system consisting of 16 RISA sequencers, which can process 50,000 DNA samples per day. One haploid genome shotgun sequence of a higher organism, such as human, mouse, rat, domestic animals, and plants, can be revealed by seven RISA systems within one month.