0610010K06Rik | GeneID:71678 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 71678 Official Symbol 0610010K06Rik
Locus N/A Gene Type protein-coding
Synonyms
Full Name RIKEN cDNA 0610010K06 gene
Description RIKEN cDNA 0610010K06 gene
Chromosome N/A
Also Known As hypothetical protein LOC71678
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 13499

ID Symbol Protein Species
GeneID:71678 0610010K06Rik NP_082137.1 Mus musculus
GeneID:148362 C1orf58 NP_653296.2 Homo sapiens
GeneID:179255 B0507.2 NP_505261.2 Caenorhabditis elegans
GeneID:305031 RGD1307161 NP_001020840.1 Rattus norvegicus
GeneID:421334 C1orf58 XP_419397.1 Gallus gallus
GeneID:434077 EG434077 XP_485815.1 Mus musculus
GeneID:457760 LOC457760 XP_001173118.1 Pan troglodytes
GeneID:478996 LOC478996 XP_536151.2 Canis lupus familiaris
GeneID:492786 zgc:101706 NP_001007428.1 Danio rerio
GeneID:522319 LOC522319 XP_600599.3 Bos taurus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016020 Component membrane

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_027861  UCSC Browser NP_082137

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000057062 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENSMUST00000057062 MI0000241 mmu-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENSMUST00000057062 MI0000713 mmu-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENSMUST00000057062 MI0000615 mmu-miR-337-5p GAACGGCGUCAUGCAGGAGUU
ENSMUST00000057062 MI0004637 mmu-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU
ENSMUST00000057062 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENSMUST00000057062 MI0004659 mmu-miR-691 AUUCCUGAAGAGAGGCAGAAAA
ENSMUST00000057062 MI0000581 mmu-miR-93* ACUGCUGAGCUAGCACUUCCCG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  2. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  3. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  5. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  6. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  7. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  8. [ + ] Tanaka TS, et al. (2000) "Genome-wide expression profiling of mid-gestation placenta and embryo using a 15,000 mouse developmental cDNA microarray." Proc Natl Acad Sci U S A. 97(16):9127-9132. PMID:10922068
  9. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
  10. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548