0610010F05Rik | GeneID:71675 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 71675 Official Symbol 0610010F05Rik
Locus RP23-188K3.6 Gene Type protein-coding
Synonyms mKIAA1841
Full Name RIKEN cDNA 0610010F05 gene
Description RIKEN cDNA 0610010F05 gene
Chromosome 11 A3.3
Also Known As OTTMUSP00000005450; hypothetical protein LOC71675
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 19038

ID Symbol Protein Species
GeneID:39134 CG6761 NP_648346.1 Drosophila melanogaster
GeneID:71675 0610010F05Rik NP_082136.2 Mus musculus
GeneID:84542 KIAA1841 NP_115895.1 Homo sapiens
GeneID:305579 RGD1305110 XP_223682.4 Rattus norvegicus
GeneID:421196 KIAA1841 XP_419274.2 Gallus gallus
GeneID:459261 KIAA1841 XP_001160368.1 Pan troglodytes
GeneID:481384 LOC481384 XP_538505.2 Canis lupus familiaris
GeneID:538151 LOC538151 XP_618347.3 Bos taurus
GeneID:793185 LOC793185 XP_001332896.2 Danio rerio
GeneID:793832 LOC793832 XP_001333668.2 Danio rerio
GeneID:3289865 AgaP_AGAP004888 XP_558222.1 Anopheles gambiae

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_027860  UCSC Browser NP_082136

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000043356 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENSMUST00000043356 MI0003154 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG
ENSMUST00000043356 MI0003160 hsa-miR-524-5p CUACAAAGGGAAGCACUUUCUC
ENSMUST00000043356 MI0003629 hsa-miR-616 AGUCAUUGGAGGGUUUGAGCAG
ENSMUST00000043356 MI0000167 mmu-miR-142-5p CAUAAAGUAGAAAGCACUACU
ENSMUST00000043356 MI0000176 mmu-miR-154* AAUCAUACACGGUUGACCUAUU
ENSMUST00000043356 MI0000761 mmu-miR-361 UUAUCAGAAUCUCCAGGGGUAC
ENSMUST00000043356 MI0003535 mmu-miR-369-5p AGAUCGACCGUGUUAUAUUCGC
ENSMUST00000043356 MI0001734 mmu-miR-452 UGUUUGCAGAGGAAACUGAGAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  2. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  3. [ + ] Okazaki N, et al. (2003) "Prediction of the coding sequences of mouse homologues of KIAA gene: III. the complete nucleotide sequences of 500 mouse KIAA-homologous cDNAs identified by screening of terminal sequences of cDNA clones randomly sampled from size-fractionated libraries." DNA Res. 10(4):167-180. PMID:14621295
  4. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Wheeler DL, et al. (2001) "Database resources of the National Center for Biotechnology Information." Nucleic Acids Res. 29(1):11-16. PMID:11125038
  7. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  8. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  9. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  10. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636