0610007L01Rik | GeneID:71667 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 71667 Official Symbol 0610007L01Rik
Locus N/A Gene Type protein-coding
Synonyms A930023A16Rik; AW557951; G430067H08Rik
Full Name RIKEN cDNA 0610007L01 gene
Description RIKEN cDNA 0610007L01 gene
Chromosome 5 F
Also Known As hypothetical protein LOC71667
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 9951

ID Symbol Protein Species
GeneID:55069 C7orf42 NP_060464.1 Homo sapiens
GeneID:71667 0610007L01Rik NP_001074863.1 Mus musculus
GeneID:288616 MGC94190 NP_001004204.1 Rattus norvegicus
GeneID:417549 C7orf42 XP_415797.1 Gallus gallus
GeneID:463454 LOC463454 XP_519133.2 Pan troglodytes
GeneID:479707 LOC479707 XP_536835.2 Canis lupus familiaris
GeneID:511252 C25H7orf42 NP_001039546.1 Bos taurus
GeneID:541403 zgc:103561 NP_001013548.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001081394  UCSC Browser NP_001074863

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000065329 MI0003142 hsa-miR-498 UUUCAAGCCAGGGGGCGUUUUUC
ENSMUST00000065329 MI0003140 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENSMUST00000065329 MI0003141 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENSMUST00000065329 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENSMUST00000065329 MI0000722 mmu-miR-138* CGGCUACUUCACAACACCAGGG
ENSMUST00000065329 MI0000402 mmu-miR-302a UAAGUGCUUCCAUGUUUUGGUGA
ENSMUST00000065329 MI0003716 mmu-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENSMUST00000065329 MI0003718 mmu-miR-302d UAAGUGCUUCCAUGUUUGAGUGU
ENSMUST00000065329 MI0000592 mmu-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Hoffman BG, et al. (2008) "Identification of transcripts with enriched expression in the developing and adult pancreas." Genome Biol. 9(6):R99. PMID:18554416
  2. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  3. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  4. [ + ] Watahiki A, et al. (2004) "Libraries enriched for alternatively spliced exons reveal splicing patterns in melanocytes and melanomas." Nat Methods. 1(3):233-239. PMID:15782199
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  7. [ + ] Piao Y, et al. (2001) "Construction of long-transcript enriched cDNA libraries from submicrogram amounts of total RNAs by a universal PCR amplification method." Genome Res. 11(9):1553-1558. PMID:11544199
  8. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  9. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  10. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  11. [ + ] Tanaka TS, et al. (2000) "Genome-wide expression profiling of mid-gestation placenta and embryo using a 15,000 mouse developmental cDNA microarray." Proc Natl Acad Sci U S A. 97(16):9127-9132. PMID:10922068
  12. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
  13. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548