ACTC1 | GeneID:70 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 70 Official Symbol ACTC1
Locus N/A Gene Type protein-coding
Synonyms ACTC; ASD5; CMD1R; CMH11
Full Name actin, alpha, cardiac muscle 1
Description actin, alpha, cardiac muscle 1
Chromosome 15q11-q14
Also Known As cardiac muscle alpha actin 1
Summary Actins are highly conserved proteins that are involved in various types of cell motility. Polymerization of globular actin (G-actin) leads to a structural filament (F-actin) in the form of a two-stranded helix. Each actin can bind to four others. The protein encoded by this gene belongs to the actin family which is comprised of three main groups of actin isoforms, alpha, beta, and gamma. The alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. Defects in this gene have been associated with idiopathic dilated cardiomyopathy (IDC) and familial hypertrophic cardiomyopathy (FHC). [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68446

ID Symbol Protein Species
GeneID:70 ACTC1 NP_005150.1 Homo sapiens
GeneID:11464 Actc1 NP_033738.1 Mus musculus
GeneID:29275 Actc1 NP_062056.1 Rattus norvegicus
GeneID:41885 Act88F NP_524367.1 Drosophila melanogaster
GeneID:58114 acta1 NP_571666.1 Danio rerio
GeneID:423298 ACTC1 XP_421217.2 Gallus gallus
GeneID:453307 ACTC1 XP_001135141.1 Pan troglodytes
GeneID:478250 ACTC1 XP_535424.1 Canis lupus familiaris
GeneID:533219 ACTC1 NP_001029757.1 Bos taurus
GeneID:818339 ACT1 NP_001031504.1 Arabidopsis thaliana
GeneID:824542 ACT3 NP_566988.1 Arabidopsis thaliana
GeneID:1275176 ENSANGG00000012538 XP_314407.2 Anopheles gambiae
GeneID:4334702 Os03g0836000 NP_001051822.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab7813 muscle Actin antibody [HHF35] (ab7813); Mouse monoclonal [HHF35] to muscle Actin
2 abcam ab838 muscle Actin antibody [HHF35], prediluted (ab838); Mouse monoclonal [HHF35] to muscle Actin, prediluted
3 abcam ab75373 Pan Muscle Alpha Actin antibody [MSA06], prediluted (ab75373); Mouse monoclonal [MSA06] to Pan Muscle Alpha Actin , prediluted
4 abcam ab69512 Actin antibody (ab69512); Rabbit polyclonal to Actin
5 abcam ab59340 Actin antibody (ab59340); Rabbit polyclonal to Actin
6 abcam ab52220 Actin antibody (ab52220); Rabbit polyclonal to Actin
7 abcam ab49672 alpha sarcomeric Actin antibody [5C5] (ab49672); Mouse monoclonal [5C5] to alpha sarcomeric Actin
8 abcam ab46805 muscle Actin antibody [EP184E] (ab46805); Rabbit monoclonal [EP184E] to muscle Actin
9 abcam ab40864 Actin antibody [C4] (ab40864); Mouse monoclonal [C4] to Actin
10 abcam ab37063 Actin antibody - Loading Control (ab37063); Rabbit polyclonal to Actin - Loading Control
11 abcam ab14130 Actin antibody (ab14130); Rabbit polyclonal to Actin
12 abcam ab7799 alpha sarcomeric Actin antibody [5C5] (ab7799); Mouse monoclonal [5C5] to alpha sarcomeric Actin
13 abcam ab11006 Actin antibody [KJ43A] (ab11006); Mouse monoclonal [KJ43A] to Actin
14 abcam ab3280 Actin antibody [ACTN05 (C4)] (ab3280); Mouse monoclonal [ACTN05 (C4)] to Actin
15 abcam ab17797 Actin antibody [SPM160] (ab17797); Mouse monoclonal [SPM160] to Actin
16 abcam ab17853 Actin antibody [SPM160], prediluted (ab17853); Mouse monoclonal [SPM160] to Actin, prediluted
17 abcam ab1801 Actin antibody (ab1801); Rabbit polyclonal to Actin
18 abcam ab11003 Actin antibody [AC-40] (ab11003); Mouse monoclonal [AC-40] to Actin
19 abcam ab11004 Actin antibody [AC-40] (Cy3) (ab11004); Mouse monoclonal [AC-40] to Actin (Cy3)
20 abcam ab11005 Actin antibody [AC-40] (FITC) (ab11005); Mouse monoclonal [AC-40] to Actin (FITC)
21 abcam ab17146 Actin antibody [1A4+5C5] (ab17146); Mouse monoclonal [1A4+5C5] to Actin
22 abcam ab18146 Actin antibody [3F10] (ab18146); Mouse monoclonal [3F10] to Actin
23 abcam ab14129 Actin antibody [3G1] (ab14129); Mouse monoclonal [3G1] to Actin
24 abgent AP1491a ACTB/ACTC Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
25 abgent AP1491c ACTB/ACTC Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
26 acris AP11506PU-N alpha 1 cardiac muscle Actin / ACTC1 (Center); antibody Ab
27 acris AP11505PU-N alpha 1 cardiac muscle Actin / ACTC1 (N-term); antibody Ab
28 acris BM5079 alpha 1 cardiac muscle Actin / ACTC1; antibody Ab
29 scbt ACTC1 ACTC1 Antibody / ACTC1 Antibodies;
30 sigma F3046 Monoclonal Anti-Actin–FITC antibody produced in mouse ;
31 sigma A2172 Monoclonal Anti-Actin (α-Sarcomeric) antibody produced in mouse ;
32 sigma A2103 Anti-Actin, N-terminal antibody produced in rabbit ;
33 sigma A3853 Monoclonal Anti-Actin antibody produced in mouse ;
34 sigma A4700 Monoclonal Anti-Actin antibody produced in mouse ;
35 sigma C5838 Monoclonal Anti-Actin–Cy3 antibody produced in mouse ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACTC1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACTC1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0042643 Component actomyosin, actin part
GO:0005737 Component cytoplasm
GO:0005856 Component cytoskeleton
GO:0031674 Component I band
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0017022 Function myosin binding
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0030048 Process actin filament-based movement
GO:0031032 Process actomyosin structure organization
GO:0006915 Process apoptosis
GO:0055008 Process cardiac muscle tissue morphogenesis
GO:0055003 Process cardiac myofibril assembly
GO:0060047 Process heart contraction
GO:0030240 Process muscle thin filament assembly

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_005159  UCSC Browser NP_005150

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000290378 MI0000103 hsa-miR-101 UACAGUACUGUGAUAACUGAA
ENST00000290378 MI0000739 hsa-miR-101 UACAGUACUGUGAUAACUGAA
ENST00000290378 MI0000458 hsa-miR-142-5p CAUAAAGUAGAAAGCACUACU
ENST00000290378 MI0000459 hsa-miR-143 UGAGAUGAAGCACUGUAGCUC
ENST00000290378 MI0000069 hsa-miR-15a UAGCAGCACAUAAUGGUUUGUG
ENST00000290378 MI0000070 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000290378 MI0000115 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000290378 MI0000482 hsa-miR-185 UGGAGAGAAAGGCAGUUCCUGA
ENST00000290378 MI0000489 hsa-miR-195 UAGCAGCACAGAAAUAUUGGC
ENST00000290378 MI0000342 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGA
ENST00000290378 MI0000650 hsa-miR-200c UAAUACUGCCGGGUAAUGAUGGA
ENST00000290378 MI0000286 hsa-miR-210 CUGUGCGUGUGACAGCGGCUGA
ENST00000290378 MI0000082 hsa-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENST00000290378 MI0000105 hsa-miR-29b-1* GCUGGUUUCAUAUGGUGGUUUAGA
ENST00000290378 MI0005568 hsa-miR-301b CAGUGCAAUGAUAUUGUCAAAGC
ENST00000290378 MI0000088 hsa-miR-30a UGUAAACAUCCUCGACUGGAAG
ENST00000290378 MI0000441 hsa-miR-30b UGUAAACAUCCUACACUCAGCU
ENST00000290378 MI0000441 hsa-miR-30b* CUGGGAGGUGGAUGUUUACUUC
ENST00000290378 MI0000254 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000290378 MI0000736 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000290378 MI0000255 hsa-miR-30d UGUAAACAUCCCCGACUGGAAG
ENST00000290378 MI0000749 hsa-miR-30e UGUAAACAUCCUUGACUGGAAG
ENST00000290378 MI0000090 hsa-miR-32 UAUUGCACAUUACUAAGUUGCA
ENST00000290378 MI0000802 hsa-miR-340 UUAUAAAGCAAUGAGACUGAUU
ENST00000290378 MI0000764 hsa-miR-363 AAUUGCACGGUAUCCAUCUGUA
ENST00000290378 MI0000775 hsa-miR-367 AAUUGCACUUUAGCAAUGGUGA
ENST00000290378 MI0000777 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENST00000290378 MI0000779 hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU
ENST00000290378 MI0000786 hsa-miR-378* CUCCUGACUCCAGGUCCUGUGU
ENST00000290378 MI0000787 hsa-miR-379 UGGUAGACUAUGGAACGUAGG
ENST00000290378 MI0001641 hsa-miR-429 UAAUACUGUCUGGUAAAACCGU
ENST00000290378 MI0001721 hsa-miR-431* CAGGUCGUCUUGCAGGGCUUCU
ENST00000290378 MI0001729 hsa-miR-451 AAACCGUUACCAUUACUGAGUU
ENST00000290378 MI0003135 hsa-miR-495 AAACAAACAUGGUGCACUUCUU
ENST00000290378 MI0003136 hsa-miR-496 UGAGUAUUACAUGGCCAAUCUC
ENST00000290378 MI0003194 hsa-miR-507 UUUUGCACCUUUUGGAGUGAA
ENST00000290378 MI0003195 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG
ENST00000290378 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000290378 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000290378 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000290378 MI0003593 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENST00000290378 MI0003598 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENST00000290378 MI0003612 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENST00000290378 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENST00000290378 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENST00000290378 MI0003624 hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC
ENST00000290378 MI0000263 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000290378 MI0000264 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000290378 MI0000265 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000290378 MI0000263 hsa-miR-7-1* CAACAAAUCACAGUCUGCCAUA
ENST00000290378 MI0000264 hsa-miR-7-2* CAACAAAUCCCAGUCUACCUAA
ENST00000290378 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENST00000290378 MI0000093 hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENST00000290378 MI0000094 hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENST00000290378 MI0003560 hsa-miR-92b UAUUGCACUCGUCCCGGCCUCC
ENST00000290378 MI0005758 hsa-miR-936 ACAGUAGAGGGAGGAAUCGCAG
ENST00000290378 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENST00000290378 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000290378 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000290378 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000290378 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENST00000290378 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENST00000290378 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENST00000290378 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000290378 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000290378 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000290378 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENST00000290378 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENST00000290378 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU
ENST00000290378 MI0004652 mmu-miR-687 CUAUCCUGGAAUGCAGCAAUGA
ENST00000290378 MI0004694 mmu-miR-710 CCAAGUCUUGGGGAGAGUUGAG
ENST00000290378 MI0005205 mmu-miR-741 UGAGAGAUGCCAUUCUAUGUAGA
ENST00000290378 MI0005204 mmu-miR-805 GAAUUGAUCAGGACAUAGGG
ENST00000290378 MI0005475 mmu-miR-882 AGGAGAGAGUUAGCGCAUUAGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
2-methylbutyric acid 4-((1,3)dioxan-5-ylmethoxyimino)-8-(2-(4-hydroxy-6-oxo-tetrahydropyran-2-yl)ethyl -7-methyl-6-oxo-1,2,3,4,6,7,8,8a-octahydronaphthyl)heptanoate
  • 2-methylbutyric acid 4-((1,3)dioxan-5-ylmethoxyimino)-8-(2-(4-hydroxy-6-oxo-tetrahydropyran-2-yl)ethyl -7-methyl-6-oxo-1,2,3,4,6,7,8,8a-octahydronaphthyl)heptanoate results in increased expression of ACTC1 mRNA
17327690
Acetaminophen
  • Acetaminophen affects the expression of ACTC1 mRNA
17562736
Acrolein
  • Acrolein affects the metabolism of ACTC1 protein
17921335
bexarotene
  • bexarotene results in increased expression of ACTC1 mRNA
16648578
BXL628
  • BXL628 results in decreased expression of ACTC1 mRNA
16003237
Carmustine
  • Carmustine results in decreased expression of ACTC1 mRNA
15980968
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of ACTC1 mRNA
17555576
Folic Acid
  • Folic Acid affects the expression of ACTC1 mRNA
17320366
Methimazole
  • Methimazole results in increased expression of ACTC1 mRNA
17403546
nickel sulfate
  • nickel sulfate results in decreased expression of ACTC1 mRNA
16100012
perchlorate
  • perchlorate results in increased expression of ACTC1 mRNA
17403546
Propylthiouracil
  • Propylthiouracil results in increased expression of ACTC1 mRNA
17403546
Tamoxifen
  • Tamoxifen affects the expression of ACTC1 mRNA
17555576
Zinc
  • Zinc results in decreased expression of ACTC1 mRNA
17074742
Zinc Sulfate
  • Zinc Sulfate results in decreased expression of ACTC1 mRNA
17074742

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Cardiomyopathy, Dilated marker
CARDIOMYOPATHY, FAMILIAL HYPERTROPHIC marker
CARDIOMYOPATHY, FAMILIAL HYPERTROPHIC, 11 marker
Hepatolenticular Degeneration inferred via Zinc Sulfate 17063115
Acrodermatitis inferred via Zinc 17190629, 17202136, 16889938
Alzheimer Disease inferred via Zinc 17119284, 16325427, 16580781, 16410023
Anemia, Sickle Cell inferred via Zinc 16916123
Asthma inferred via Zinc 17085522
Brain Injuries inferred via Zinc 17109824
Carcinoma, Squamous Cell inferred via Zinc 16543248
Cardiovascular Diseases inferred via Zinc 16936243
Diabetes Mellitus inferred via Zinc 16479319
Esophageal Neoplasms inferred via Zinc 16543248
Gastritis inferred via Zinc 17241300
Growth Disorders inferred via Zinc 17217573
Heart Failure inferred via Zinc 17162251
Heart Injuries inferred via Zinc 17074742
Helicobacter Infections inferred via Zinc 17241300
Hepatolenticular Degeneration inferred via Zinc 17276780
Ischemia inferred via Zinc 16584753
Kidney Diseases inferred via Zinc 16960431
Kidney Failure, Chronic inferred via Zinc 16518626
Mammary Neoplasms, Experimental inferred via Zinc 12773700
Pre-Eclampsia inferred via Zinc 17114810
Prostatic Neoplasms inferred via Zinc 12429649, 16517595, 16700911, 16606632
Retinal Degeneration inferred via Zinc 16584753
Tongue Neoplasms inferred via Zinc 16543248
Breast Neoplasms inferred via Tamoxifen 16202921, 16818667, 11161223, 15668708, 17440819, 17893378, 17261762, 17049068, 16873071, 15565566, 17242785
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 16827153, 14580682
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Thyroid Neoplasms inferred via Propylthiouracil 15710170
Dermatitis, Allergic Contact inferred via nickel sulfate 16780908
Hyperthyroidism inferred via Methimazole 14678291
Adenoma inferred via Folic Acid 16963246
Alzheimer Disease inferred via Folic Acid 17116317
Breast Neoplasms inferred via Folic Acid 16777985
Cardiovascular Diseases inferred via Folic Acid 16755160
Colorectal Neoplasms inferred via Folic Acid 16963246, 17087956, 16985020, 17116713, 17245555
Diabetes Mellitus, Type 2 inferred via Folic Acid 16886840
Endometrial Neoplasms inferred via Folic Acid 17301261
Exfoliation Syndrome inferred via Folic Acid 16504073
Gastritis inferred via Folic Acid 17171786
Glaucoma inferred via Folic Acid 16504073
Heart Defects, Congenital inferred via Folic Acid 17286298, 16524890
HIV Seropositivity inferred via Folic Acid 17209195
Hyperhomocysteinemia inferred via Folic Acid 16397167, 16395265, 16433478, 16755160, 16865747
Liver Diseases inferred via Folic Acid 16877991
Lupus Erythematosus, Systemic inferred via Folic Acid 17718048
Maxillofacial Abnormalities inferred via Folic Acid 16832597
Neural Tube Defects inferred via Folic Acid 17438019
Neutropenia inferred via Folic Acid 16322990
Schizophrenia inferred via Folic Acid 16641680
Spinal Cord Diseases inferred via Folic Acid 16361298
Stomach Neoplasms inferred via Folic Acid 17171786
Stroke inferred via Folic Acid 16517955
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16105132, 11677210, 15861022, 17333356, 16919318, 17681005
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Brain Neoplasms inferred via Carmustine 16187019
Glioblastoma inferred via Carmustine 16187019
Melanoma inferred via Carmustine 12393984
Prostatic Hyperplasia inferred via BXL628 15572423, 16957418
Breast Neoplasms inferred via bexarotene 16818667, 16344269
Carcinoma, Non-Small-Cell Lung inferred via bexarotene 16247446
Lung Neoplasms inferred via bexarotene 17849452
Lymphoma, T-Cell, Cutaneous inferred via bexarotene 11161223
Mammary Neoplasms, Experimental inferred via bexarotene 15591091
Alzheimer Disease inferred via Acrolein 14715435, 17570602, 15207723
Arteriosclerosis inferred via Acrolein 15014928
Atherosclerosis inferred via Acrolein 17363696, 16037261, 16126721
Colorectal Neoplasms inferred via Acrolein 17597105
Kidney Diseases inferred via Acrolein 12488133
Kidney Failure inferred via Acrolein 12732208
Lung Diseases inferred via Acrolein 11504702
Melanoma, Experimental inferred via Acrolein 10803710
Neoplasms inferred via Acrolein 17329238
Nephritis inferred via Acrolein 12653641
Neurodegenerative Diseases inferred via Acrolein 11342003
Parkinson Disease inferred via Acrolein 17690948
Photosensitivity Disorders inferred via Acrolein 11550810
Stroke inferred via Acrolein 16269634
Hepatitis, Toxic inferred via Acetaminophen 2444490, 14986274, 16227642, 15968718, 16177239, 17562736, 16081117, 17522070
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ravenscroft G, et al. (2008) "Expression of cardiac alpha-actin spares extraocular muscles in skeletal muscle alpha-actin diseases--quantification of striated alpha-actins by MRM-mass spectrometry." Neuromuscul Disord. 18(12):953-958. PMID:18952430
  2. [ + ] Iwasa M, et al. (2008) "Dual roles of Gln137 of actin revealed by recombinant human cardiac muscle alpha-actin mutants." J Biol Chem. 283(30):21045-21053. PMID:18515362
  3. [ + ] Bos JM, et al. (2008) "Relationship between sex, shape, and substrate in hypertrophic cardiomyopathy." Am Heart J. 155(6):1128-1134. PMID:18513529
  4. [ + ] Klaassen S, et al. (2008) "Mutations in sarcomere protein genes in left ventricular noncompaction." Circulation. 117(22):2893-2901. PMID:18506004
  5. [ + ] Miller BM, et al. (2008) "Functional effects of nemaline myopathy mutations on human skeletal alpha-actin." J Biol Chem. 283(28):19379-19388. PMID:18477565
  6. [ + ] Matsson H, et al. (2008) "Alpha-cardiac actin mutations produce atrial septal defects." Hum Mol Genet. 17(2):256-265. PMID:17947298
  7. [ + ] Morita H, et al. (2008) "Shared genetic causes of cardiac hypertrophy in children and adults." N Engl J Med. 358(18):1899-1908. PMID:18403758
  8. [ + ] Monserrat L, et al. (2007) "Mutation in the alpha-cardiac actin gene associated with apical hypertrophic cardiomyopathy, left ventricular non-compaction, and septal defects." Eur Heart J. 28(16):1953-1961. PMID:17611253
  9. [ + ] Yates SP, et al. (2007) "Overexpression of cardiac actin with baculovirus is promoter dependent." Arch Biochem Biophys. 466(1):58-65. PMID:17765196
  10. [ + ] Bouldin AA, et al. (2007) "Variable presentation of nemaline myopathy: novel mutation of alpha actin gene." Muscle Nerve. 35(2):254-258. PMID:16967490
  11. [ + ] Coiras M, et al. (2006) "Modifications in the human T cell proteome induced by intracellular HIV-1 Tat protein expression." Proteomics. 6 Suppl 1():S63-S73. PMID:16526095
  12. [ + ] Morita H, et al. (2006) "Single-gene mutations and increased left ventricular wall thickness in the community: the Framingham Heart Study." Circulation. 113(23):2697-2705. PMID:16754800
  13. [ + ] Bookwalter CS, et al. (2006) "Functional consequences of a mutation in an expressed human alpha-cardiac actin at a site implicated in familial hypertrophic cardiomyopathy." J Biol Chem. 281(24):16777-16784. PMID:16611632
  14. [ + ] Ingles J, et al. (2005) "Compound and double mutations in patients with hypertrophic cardiomyopathy: implications for genetic testing and counselling." J Med Genet. 42(10):e59. PMID:16199542
  15. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  16. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  17. [ + ] Zheng B, et al. (2004) "hhLIM protein is involved in cardiac hypertrophy." Biochim Biophys Acta. 1690(1):1-10. PMID:15337165
  18. [ + ] Caloca MJ, et al. (2004) "F-actin-dependent translocation of the Rap1 GDP/GTP exchange factor RasGRP2." J Biol Chem. 279(19):20435-20446. PMID:14988412
  19. [ + ] Navarro-Lerida I, et al. (2004) "Proteomic identification of brain proteins that interact with dynein light chain LC8." Proteomics. 4(2):339-346. PMID:14760703
  20. [ + ] Wu RF, et al. (2004) "Human immunodeficiency virus type 1 Tat regulates endothelial cell actin cytoskeletal dynamics through PAK1 activation and oxidant production." J Virol. 78(2):779-789. PMID:14694110
  21. [ + ] Verboven C, et al. (2003) "Actin-DBP: the perfect structural fit?" Acta Crystallogr D Biol Crystallogr. 59(Pt 2):263-273. PMID:12554937
  22. [ + ] Takeuchi T, et al. (2003) "Down-regulation of a novel actin-binding molecule, skeletrophin, in malignant melanoma." Am J Pathol. 163(4):1395-1404. PMID:14507647
  23. [ + ] Zhao Y, et al. (2003) "Cloning and characterization of a novel cardiac-specific kinase that interacts specifically with cardiac troponin I." J Mol Med. 81(5):297-304. PMID:12721663
  24. [ + ] Hsieh-Wilson LC, et al. (2003) "Phosphorylation of spinophilin modulates its interaction with actin filaments." J Biol Chem. 278(2):1186-1194. PMID:12417592
  25. [ + ] Zhen YY, et al. (2002) "NUANCE, a giant protein connecting the nucleus and actin cytoskeleton." J Cell Sci. 115(Pt 15):3207-3222. PMID:12118075
  26. [ + ] Tachado SD, et al. (2002) "Regulation of tumor invasion and metastasis in protein kinase C epsilon-transformed NIH3T3 fibroblasts." J Cell Biochem. 85(4):785-797. PMID:11968018
  27. [ + ] Arai A, et al. (2002) "STARS, a striated muscle activator of Rho signaling and serum response factor-dependent transcription." J Biol Chem. 277(27):24453-24459. PMID:11983702
  28. [ + ] Sadeghi A, et al. (2002) "Regulation of the cardiac L-type Ca2+ channel by the actin-binding proteins alpha-actinin and dystrophin." Am J Physiol Cell Physiol. 282(6):C1502-C1511. PMID:11997265
  29. [ + ] Khanna R, et al. (2002) "Headpiece domain of dematin is required for the stability of the erythrocyte membrane." Proc Natl Acad Sci U S A. 99(10):6637-6642. PMID:12011427
  30. [ + ] Bearer EL, et al. (2002) "Actin dynamics in platelets." Int Rev Cytol. 217():137-182. PMID:12019562
  31. [ + ] Scott MP, et al. (2002) "Identification of novel SH3 domain ligands for the Src family kinase Hck. Wiskott-Aldrich syndrome protein (WASP), WASP-interacting protein (WIP), and ELMO1." J Biol Chem. 277(31):28238-28246. PMID:12029088
  32. [ + ] Patrie KM, et al. (2002) "Interaction of two actin-binding proteins, synaptopodin and alpha-actinin-4, with the tight junction protein MAGI-1." J Biol Chem. 277(33):30183-30190. PMID:12042308
  33. [ + ] Chen Y, et al. (2002) "Actinfilin, a brain-specific actin-binding protein in postsynaptic density." J Biol Chem. 277(34):30495-30501. PMID:12063253
  34. [ + ] Garcia JG, et al. (2002) "Critical involvement of p38 MAP kinase in pertussis toxin-induced cytoskeletal reorganization and lung permeability." FASEB J. 16(9):1064-1076. PMID:12087068
  35. [ + ] Smith L, et al. (2002) "Properties of long myosin light chain kinase binding to F-actin in vitro and in vivo." J Biol Chem. 277(38):35597-35604. PMID:12110694
  36. [ + ] Qian Y, et al. (2002) "PC phosphorylation increases the ability of AFAP-110 to cross-link actin filaments." Mol Biol Cell. 13(7):2311-2322. PMID:12134071
  37. [ + ] Urbanikova L, et al. (2002) "Purification, crystallization and preliminary X-ray analysis of the plectin actin-binding domain." Acta Crystallogr D Biol Crystallogr. 58(Pt 8):1368-1370. PMID:12136158
  38. [ + ] Goncharuk VN, et al. (2002) "Actin-binding protein fascin expression in skin neoplasia." J Cutan Pathol. 29(7):430-438. PMID:12139639
  39. [ + ] Paavilainen VO, et al. (2002) "Structural conservation between the actin monomer-binding sites of twinfilin and actin-depolymerizing factor (ADF)/cofilin." J Biol Chem. 277(45):43089-43095. PMID:12207032
  40. [ + ] Terry-Lorenzo RT, et al. (2002) "Neurabins recruit protein phosphatase-1 and inhibitor-2 to the actin cytoskeleton." J Biol Chem. 277(48):46535-46543. PMID:12270929
  41. [ + ] Coscoy S, et al. (2002) "Molecular analysis of microscopic ezrin dynamics by two-photon FRAP." Proc Natl Acad Sci U S A. 99(20):12813-12818. PMID:12271120
  42. [ + ] Jiang LQ, et al. (2002) "Screening the proteins that interact with calpain in a human heart cDNA library using a yeast two-hybrid system." Hypertens Res. 25(4):647-652. PMID:12358155
  43. [ + ] Zhang Q, et al. (2002) "The nesprins are giant actin-binding proteins, orthologous to Drosophila melanogaster muscle protein MSP-300." Genomics. 80(5):473-481. PMID:12408964
  44. [ + ] Lejen T, et al. (2002) "The role of different Scinderin domains in the control of F-actin cytoskeleton during exocytosis." Ann N Y Acad Sci. 971():248-250. PMID:12438125
  45. [ + ] Bayes-Genis A, et al. (2002) "Host cell-derived cardiomyocytes in sex-mismatch cardiac allografts." Cardiovasc Res. 56(3):404-410. PMID:12445881
  46. [ + ] Buch S, et al. (2002) "Binding of a C-terminal fragment (residues 369 to 435) of vitamin D-binding protein to actin." Biol Chem. 383(10):1621-1631. PMID:12452439
  47. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  48. [ + ] Busch HJ, et al. (2001) "Actin in semithin sections of myocardial biopsies as a tool to visualize myofibrillary degradation in humans." Cell Mol Biol (Noisy-le-grand). 47 Online Pub():OL89-OL94. PMID:11936879
  49. [ + ] Olson TM, et al. (2000) "Inherited and de novo mutations in the cardiac actin gene cause hypertrophic cardiomyopathy." J Mol Cell Cardiol. 32(9):1687-1694. PMID:10966831