Aatk | GeneID:690853 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 690853 Official Symbol Aatk
Locus N/A Gene Type protein-coding
Synonyms
Full Name apoptosis-associated tyrosine kinase
Description apoptosis-associated tyrosine kinase
Chromosome 10q32.3
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 74861

ID Symbol Protein Species
GeneID:9625 AATK NP_001073864.1 Homo sapiens
GeneID:11302 Aatk NP_031403.2 Mus musculus
GeneID:511515 AATK XP_588863.3 Bos taurus
GeneID:555739 LOC555739 XP_683424.3 Danio rerio
GeneID:690853 Aatk XP_001075880.1 Rattus norvegicus
GeneID:100004850 LOC100004850 XP_001344052.2 Danio rerio
GeneID:100149793 LOC100149793 XP_001920174.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005739 Component mitochondrion
GO:0005515 Function protein binding
GO:0006915 Process apoptosis

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001075880  UCSC Browser XP_001075880
2 XM_001081776  UCSC Browser XP_001081776

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000005839 MI0000779 hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU
ENSRNOT00000005839 MI0003131 hsa-miR-492 AGGACCUGCGGGACAAGAUUCUU
ENSRNOT00000005839 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENSRNOT00000005839 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENSRNOT00000005839 MI0002399 mmu-miR-464 UACCAAGUUUAUUCUGUGAGAUA
ENSRNOT00000005839 MI0004680 mmu-miR-491 AGUGGGGAACCCUUCCAUGAGG
ENSRNOT00000005839 MI0005518 mmu-miR-574-5p UGAGUGUGUGUGUGUGAGUGUGU
ENSRNOT00000005839 MI0004634 mmu-miR-677 UUCAGUGAUGAUUAGCUUCUGA
ENSRNOT00000005839 MI0004685 mmu-miR-701 UUAGCCGCUGAAAUAGAUGGA
ENSRNOT00000005839 MI0000885 rno-miR-100 AACCCGUAGAUCCGAACUUGUG
ENSRNOT00000005839 MI0000916 rno-miR-143 UGAGAUGAAGCACUGUAGCUCA
ENSRNOT00000005839 MI0000843 rno-miR-15b UAGCAGCACAUCAUGGUUUACA
ENSRNOT00000005839 MI0000966 rno-miR-292-3p AAGUGCCGCCAGGUUUUGAGUGU
ENSRNOT00000005839 MI0000967 rno-miR-296 GAGGGUUGGGUGGAGGCUCUCC
ENSRNOT00000005839 MI0003724 rno-miR-497 CAGCAGCACACUGUGGUUUGUA
ENSRNOT00000005839 MI0003722 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA
ENSRNOT00000005839 MI0003723 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene