TAP2 | GeneID:6891 | Homo sapiens
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 6891 | Official Symbol | TAP2 |
|---|---|---|---|
| Locus | DAAP-57C1.2 | Gene Type | protein-coding |
| Synonyms | ABC18; ABCB3; APT2; D6S217E; PSF2; RING11 | ||
| Full Name | transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) | ||
| Description | transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) | ||
| Chromosome | 6p21.3 | ||
| Also Known As | ABC transporter, MHC 2; ATP-binding cassette, sub-family B (MDR/TAP), member 3; OTTHUMP00000029079; OTTHUMP00000038912; OTTHUMP00000038914; antigen peptide transporter 2; peptide supply factor 2; peptide transporter PSF2; transporter 2, ABC (ATP binding cassette); transporter 2, ATP-binding cassette, sub-family B | ||
| Summary | The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This gene is located 7 kb telomeric to gene family member ABCB2. The protein encoded by this gene is involved in antigen presentation. This protein forms a heterodimer with ABCB2 in order to transport peptides from the cytoplasm to the endoplasmic reticulum. Mutations in this gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Alternative splicing of this gene produces two products which differ in peptide selectivity and level of restoration of surface expression of MHC class I molecules. [provided by RefSeq] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 37323
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:6891 | TAP2 | NP_000535.3 | Homo sapiens |
| GeneID:21355 | Tap2 | NP_035660.2 | Mus musculus |
| GeneID:24812 | Tap2 | NP_114445.1 | Rattus norvegicus |
| GeneID:281586 | TAP2 | NP_776647.1 | Bos taurus |
| GeneID:368771 | abcb3l1 | NP_001006594.1 | Danio rerio |
| GeneID:474864 | TAP2 | XP_532099.2 | Canis lupus familiaris |
| GeneID:556826 | LOC556826 | XP_682981.1 | Danio rerio |
| GeneID:618733 | TAP2 | NP_001040087.1 | Bos taurus |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | abcam | ab60113 | TAP2 antibody (ab60113); Rabbit polyclonal to TAP2 |
| 2 | abgent | AP6253a | TAP2 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab) |
| 3 | acris | AP13227PU-N | TAP2 (MDR/TAP) (C-term); antibody Ab |
| 4 | scbt | TAP2 | TAP2 Antibody / TAP2 Antibodies; |
| 5 | sigma | HPA001312 | Anti-TAP2 antibody produced in rabbit ; |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005829 | Component | cytosol |
| GO:0005783 | Component | endoplasmic reticulum |
| GO:0005788 | Component | endoplasmic reticulum lumen |
| GO:0005789 | Component | endoplasmic reticulum membrane |
| GO:0016021 | Component | integral to membrane |
| GO:0016020 | Component | membrane |
| GO:0005634 | Component | nucleus |
| GO:0042825 | Component | TAP complex |
| GO:0016887 | Function | ATPase activity |
| GO:0042626 | Function | ATPase activity, coupled to transmembrane movement of substances |
| GO:0005524 | Function | ATP binding |
| GO:0004409 | Function | homoaconitate hydratase activity |
| GO:0042288 | Function | MHC class I protein binding |
| GO:0000166 | Function | nucleotide binding |
| GO:0015198 | Function | oligopeptide transporter activity |
| GO:0042605 | Function | peptide antigen binding |
| GO:0015433 | Function | peptide antigen-transporting ATPase activity |
| GO:0042301 | Function | phosphate binding |
| GO:0046982 | Function | protein heterodimerization activity |
| GO:0046980 | Function | tapasin binding |
| GO:0005215 | Function | transporter activity |
| GO:0019885 | Process | antigen processing and presentation of endogenous peptide antigen via MHC class I |
| GO:0046967 | Process | cytosol to ER transport |
| GO:0006955 | Process | immune response |
| GO:0006886 | Process | intracellular protein transport |
| GO:0006857 | Process | oligopeptide transport |
| GO:0006461 | Process | protein complex assembly |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENST00000374897 | MI0003677 | hsa-miR-655 | AUAAUACAUGGUUAACCUCUUU |
| ENST00000374899 | MI0000443 | hsa-miR-124* | CGUGUUCACAGCGGACCUUGAU |
| ENST00000374899 | MI0000444 | hsa-miR-124* | CGUGUUCACAGCGGACCUUGAU |
| ENST00000374899 | MI0000445 | hsa-miR-124* | CGUGUUCACAGCGGACCUUGAU |
| ENST00000374899 | MI0000075 | hsa-miR-19b-2* | AGUUUUGCAGGUUUGCAUUUCA |
| ENST00000374899 | MI0000295 | hsa-miR-218-2* | CAUGGUUCUGUCAAGCACCGCG |
| ENST00000374899 | MI0000740 | hsa-miR-219-2-3p | AGAAUUGUGGCUGGACAUCUGU |
| ENST00000374899 | MI0000779 | hsa-miR-371-5p | ACUCAAACUGUGGGGGCACU |
| ENST00000374899 | MI0000781 | hsa-miR-373* | ACUCAAAAUGGGGGCGCUUUCC |
| ENST00000374899 | MI0000783 | hsa-miR-375 | UUUGUUCGUUCGGCUCGCGUGA |
| ENST00000374899 | MI0000788 | hsa-miR-380* | UGGUUGACCAUAGAACAUGCGC |
| ENST00000374899 | MI0001145 | hsa-miR-384 | AUUCCUAGAAAUUGUUCAUA |
| ENST00000374899 | MI0001735 | hsa-miR-409-3p | GAAUGUUGCUCGGUGAACCCCU |
| ENST00000374899 | MI0001723 | hsa-miR-433 | AUCAUGAUGGGCUCCUCGGUGU |
| ENST00000374899 | MI0003589 | hsa-miR-582-5p | UUACAGUUGUUCAACCAGUUACU |
| ENST00000374899 | MI0003629 | hsa-miR-616* | ACUCAAAACCCUUCAGUGACUU |
| ENST00000374899 | MI0003649 | hsa-miR-634 | AACCAGCACCCCAACUUUGGAC |
| ENST00000374899 | MI0003660 | hsa-miR-645 | UCUAGGCUGGUACUGCUGA |
| ENST00000374899 | MI0005541 | hsa-miR-875-3p | CCUGGAAACACUGAGGUUGUG |
| ENST00000374899 | MI0005560 | hsa-miR-885-5p | UCCAUUACACUACCCUGCCUCU |
| ENST00000374899 | MI0005713 | hsa-miR-921 | CUAGUGAGGGACAGAACCAGGAUUC |
| ENST00000374899 | MI0000388 | mmu-miR-290-5p | ACUCAAACUAUGGGGGCACUUU |
| ENST00000374899 | MI0000390 | mmu-miR-292-5p | ACUCAAACUGGGGGCUCUUUUG |
| ENST00000374899 | MI0003523 | mmu-miR-547 | CUUGGUACAUCUUUGAGUGAG |
| ENST00000374899 | MI0004634 | mmu-miR-677 | UUCAGUGAUGAUUAGCUUCUGA |
| ENST00000374899 | MI0004652 | mmu-miR-687 | CUAUCCUGGAAUGCAGCAAUGA |
| ENST00000374899 | MI0004215 | mmu-miR-762 | GGGGCUGGGGCCGGGACAGAGC |
| ENST00000374899 | MI0005548 | mmu-miR-878-5p | UAUCUAGUUGGAUGUCAAGACA |
| ENST00000374899 | MI0005472 | mmu-miR-879 | AGAGGCUUAUAGCUCUAAGCC |
Protein Sequences
[
] Protein Accession Number Cloud [ GenPept ]
AAA58648 AAA58649 AAA59841 AAA79901 AAD12059 AAD23381 AAD23601 AAD31384 AAD32715 AAD50509 AAG12163 AAI52840 AAL07496 AAP88908 ACE87017 BAA07665 BAA11414 BAB71769 BAD92190 BAD96543 BAD97020 BAF85652 BAG61534 CAA47027 CAA60788 CAA80522 CAA80523 CAI17710 CAI17711 CAI18136 CAI18137 CAI18621 CAI18622 CAI41935 CAI41936 CAI41937 CAQ08243 CAQ08443 CAQ08444 CAQ08490 CAQ08491 CAQ10282 CAQ10283 CAR92541 EAX03642 EAX03643 NP_000535 NP_061313 O95410 Q03519 Q15547 Q53FI6 Q59H06 Q5HY71 Q5JNW1 Q96P38 Q96PT8 Q99591 Q9H4M2 Q9UMW6 Q9UP03 Q9UQ60
Chemicals and Drugs
[
] Comparative Toxicogenomics Database from MDI Biological Lab
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Gene and Diseases
[
] Gene and Diseases [Data source: CTD]
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Gene Interactions
[
] BioGRID Gene Product Interaction Database
| Symbol | Interaction Binary | Experiment | Source |
|---|---|---|---|
| HLA-C | HLA-C / TAP2 | Invivo | Neisig A (1998) |
| HLA-G | TAP2 / HLA-G | Affinity Capture-Western | Gobin SJ (1997) |
| TAP1 | TAP1 / TAP2 | Reconstituted Complex | Karttunen JT (2001) |
| TAPBP | TAPBP / TAP2 | Reconstituted Complex | Raghuraman G (2002) |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Vignal C, et al. (2009) "Genetic association of the major histocompatibility complex with rheumatoid arthritis implicates two non-DRB1 loci." Arthritis Rheum. 60(1):53-62. PMID:19116923 - [
] Hoves S, et al. (2009) "In situ analysis of the antigen-processing machinery in acute myeloid leukaemic blasts by tissue microarray." Leukemia. 23(5):877-885. PMID:19148137 - [
] Einstein MH, et al. (2009) "Genetic variants in TAP are associated with high-grade cervical neoplasia." Clin Cancer Res. 15(3):1019-1023. PMID:19188174 - [
] Mehta AM, et al. (2009) "Single nucleotide polymorphisms in antigen processing machinery component ERAP1 significantly associate with clinical outcome in cervical carcinoma." Genes Chromosomes Cancer. 48(5):410-418. PMID:19202550 - [
] Fellerhoff B, et al. (2009) "Transporter associated with antigen processing and the chaperone tapasin: are non-classical HLA genes keys to the pathogenesis of schizophrenia?" Med Hypotheses. 72(5):535-538. PMID:19217216 - [
] Siezen CL, et al. (2009) "Genetic susceptibility to respiratory syncytial virus bronchiolitis in preterm children is associated with airway remodeling genes and innate immune genes." Pediatr Infect Dis J. 28(4):333-335. PMID:19258923 - [
] Kordi Tamandani DM, et al. (2009) "No association of TAP1 and TAP2 genes polymorphism with risk of cervical cancer in north Indian population." J Assist Reprod Genet. 26(4):173-178. PMID:19263211 - [
] Oancea G, et al. (2009) "Structural arrangement of the transmission interface in the antigen ABC transport complex TAP." Proc Natl Acad Sci U S A. 106(14):5551-5556. PMID:19297616 - [
] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046 - [
] Ramos PS, et al. (2009) "Variation in the ATP-binding cassette transporter 2 gene is a separate risk factor for systemic lupus erythematosus within the MHC." Genes Immun. 10(4):350-355. PMID:19387463 - [
] Maksymowych WP, et al. (2009) "Association of a specific ERAP1/ARTS1 haplotype with disease susceptibility in ankylosing spondylitis." Arthritis Rheum. 60(5):1317-1323. PMID:19404951 - [
] Feng M, et al. (2009) "TAP1 and TAP2 polymorphisms associated with ankylosing spondylitis in genetically homogenous Chinese Han population." Hum Immunol. 70(4):257-261. PMID:19480848 - [
] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348 - [
] Soundravally R, et al. (2008) "Significance of transporter associated with antigen processing 2 (TAP2) gene polymorphisms in susceptibility to dengue viral infection." J Clin Immunol. 28(3):256-262. PMID:18071882 - [
] Deshpande A, et al. (2008) "Variation in HLA class I antigen-processing genes and susceptibility to human papillomavirus type 16-associated cervical cancer." J Infect Dis. 197(3):371-381. PMID:18248301 - [
] Lee HS, et al. (2008) "Several regions in the major histocompatibility complex confer risk for anti-CCP-antibody positive rheumatoid arthritis, independent of the DRB1 locus." Mol Med. 14(5-6):293-300. PMID:18309376 - [
] Tao J, et al. (2008) "Restoration of the expression of transports associated with antigen processing in human malignant melanoma increases tumor-specific immunity." J Invest Dermatol. 128(8):1991-1996. PMID:18385764 - [
] Soundravally R, et al. (2008) "Polymorphisms of the TAP 1 and 2 gene may influence clinical outcome of primary dengue viral infection." Scand J Immunol. 67(6):618-625. PMID:18433405 - [
] Moschonas A, et al. (2008) "CD40 induces antigen transporter and immunoproteasome gene expression in carcinomas via the coordinated action of NF-kappaB and of NF-kappaB-mediated de novo synthesis of IRF-1." Mol Cell Biol. 28(20):6208-6222. PMID:18694960 - [
] Feng ML, et al. (2008) "Determination of TAP1 and TAP2 polymorphism in the Chinese Han population by real-time TaqMan polymerase chain reaction." Tissue Antigens. 72(5):441-447. PMID:18764808 - [
] Kim JJ, et al. (2008) "Genetic variants in the HLA-G region are associated with Kawasaki disease." Hum Immunol. 69(12):867-871. PMID:18976687 - [
] Bullido MJ, et al. (2007) "A TAP2 genotype associated with Alzheimer's disease in APOE4 carriers." Neurobiol Aging. 28(4):519-523. PMID:16595160 - [
] Qu HQ, et al. (2007) "Genetic control of alternative splicing in the TAP2 gene: possible implication in the genetics of type 1 diabetes." Diabetes. 56(1):270-275. PMID:17192492 - [
] Dogru D, et al. (2007) "The role of TAP1 and TAP2 gene polymorphism in idiopathic bronchiectasis in children." Pediatr Pulmonol. 42(3):237-241. PMID:17245734 - [
] Xu C, et al. (2007) "Genetic polymorphisms of LMP/TAP gene and hepatitis B virus infection risk in the Chinese population." J Clin Immunol. 27(5):534-541. PMID:17525827 - [
] Kramer U, et al. (2007) "Strong associations of psoriasis with antigen processing LMP and transport genes TAP differ by gender and phenotype." Genes Immun. 8(6):513-517. PMID:17581627 - [
] Janssen R, et al. (2007) "Genetic susceptibility to respiratory syncytial virus bronchiolitis is predominantly associated with innate immune genes." J Infect Dis. 196(6):826-834. PMID:17703412 - [
] Rufer E, et al. (2007) "Molecular architecture of the TAP-associated MHC class I peptide-loading complex." J Immunol. 179(9):5717-5727. PMID:17947644 - [
] Kim KR, et al. (2007) "TAP1 and TAP2 gene polymorphisms in Korean patients with allergic rhinitis." J Korean Med Sci. 22(5):825-831. PMID:17982230 - [
] Halenius A, et al. (2006) "Physical and functional interactions of the cytomegalovirus US6 glycoprotein with the transporter associated with antigen processing." J Biol Chem. 281(9):5383-5390. PMID:16356928 - [
] Hahn Y, et al. (2006) "Human-specific nonsense mutations identified by genome sequence comparisons." Hum Genet. 119(1-2):169-178. PMID:16395595 - [
] Gomez LM, et al. (2006) "Analysis of IL1B, TAP1, TAP2 and IKBL polymorphisms on susceptibility to tuberculosis." Tissue Antigens. 67(4):290-296. PMID:16634865 - [
] Chen RH, et al. (2006) "Association between the TAP2 gene codon 665 polymorphism and Graves' disease." J Clin Lab Anal. 20(3):93-97. PMID:16721835 - [
] Hwang Y, et al. (2006) "Genetic predisposition of responsiveness to therapy for chronic hepatitis C." Pharmacogenomics. 7(5):697-709. PMID:16886895 - [
] Yilmaz I, et al. (2006) "No difference in polymorphism frequency in a Turkish population with allergic rhinitis." Acta Otolaryngol. 126(10):1110-1111. PMID:16923719 - [
] Perria CL, et al. (2006) "Catalytic site modifications of TAP1 and TAP2 and their functional consequences." J Biol Chem. 281(52):39839-39851. PMID:17068338 - [
] Begley GS, et al. (2005) "Cytoplasmic domains of the transporter associated with antigen processing and P-glycoprotein interact with subunits of the proteasome." Mol Immunol. 42(1):137-141. PMID:15488952 - [
] Koch J, et al. (2005) "Exploring the minimal functional unit of the transporter associated with antigen processing." FEBS Lett. 579(20):4413-4416. PMID:16061226 - [
] Song YW, et al. (2005) "Association of TAP1 and TAP2 gene polymorphisms with systemic sclerosis in Korean patients." Hum Immunol. 66(7):810-817. PMID:16112028 - [
] Procko E, et al. (2005) "Identification of domain boundaries within the N-termini of TAP1 and TAP2 and their importance in tapasin binding and tapasin-mediated increase in peptide loading of MHC class I." Immunol Cell Biol. 83(5):475-482. PMID:16174096 - [
] Zhang Z, et al. (2005) "Analysis of TAP1 and TAP2 polymorphism of mother-infant in Chinese patients with pre-eclampsia." Cell Mol Immunol. 2(2):141-144. PMID:16191421 - [
] Leonhardt RM, et al. (2005) "Critical role for the tapasin-docking site of TAP2 in the functional integrity of the MHC class I-peptide-loading complex." J Immunol. 175(8):5104-5114. PMID:16210614 - [
] Huang SH, et al. (2005) "TAP 2 gene Msp-I polymorphism might be associated with calcium oxalate stone disease." Urol Int. 75(3):264-268. PMID:16215317 - [
] Alvarado-Guerri R, et al. (2005) "TAP1 and TAP2 polymorphisms and their linkage disequilibrium with HLA-DR, -DP, and -DQ in an eastern Andalusian population." Hum Immunol. 66(8):921-930. PMID:16216677 - [
] Slomov E, et al. (2005) "Pemphigus vulgaris is associated with the transporter associated with antigen processing (TAP) system." Hum Immunol. 66(12):1213-1222. PMID:16690408 - [
] Sia C, et al. (2005) "Genetic susceptibility to type 1 diabetes in the intracellular pathway of antigen processing - a subject review and cross-study comparison." Rev Diabet Stud. 2(1):40-52. PMID:17491658 - [
] Koch J, et al. (2004) "Functional dissection of the transmembrane domains of the transporter associated with antigen processing (TAP)." J Biol Chem. 279(11):10142-10147. PMID:14679198 - [
] Yu MC, et al. (2004) "Association of TAP2 gene polymorphisms in Chinese patients with rheumatoid arthritis." Clin Rheumatol. 23(1):35-39. PMID:14749980 - [
] Jun TY, et al. (2004) "No association of TAP2 polymorphisms in Korean patients with schizophrenia." Psychiatr Genet. 14(3):173-176. PMID:15318034 - [
] Cesari M, et al. (2004) "Is TAP2*0102 allele involved in insulin-dependent diabetes mellitus (type 1) protection?" Hum Immunol. 65(8):783-793. PMID:15336779
OBJECTIVE: The HLA-DRB1 locus within the major histocompatibility complex (MHC) at 6p21.3 has been identified as a susceptibility gene for rheumatoid arthritis (RA); however, there is increasing evidence of additional susceptibility genes in the MHC region. The aim of this study was to estimate their number and location. METHODS: A case-control study was performed involving 977 control subjects and 855 RA patients. The HLA-DRB1 locus was genotyped together with 2,360 single-nucleotide polymorphisms in the MHC region. Logistic regression was used to detect DRB1-independent effects. RESULTS: After adjusting for the effect of HLA-DRB1, 18 markers in 14 genes were strongly associated with RA (P<10(-4)). Multivariate logistic regression analysis of these markers and DRB1 led to a model containing DRB1 plus the following 3 markers: rs4678, a nonsynonymous change in the VARS2L locus, approximately 1.7 Mb telomeric of DRB1; rs2442728, upstream of HLA-B, approximately 1.2 Mb telomeric of DRB1; and rs17499655, located in the 5'-untranslated region of DQA2, only 0.1 Mb centromeric of DRB1. In-depth investigation of the DQA2 association, however, suggested that it arose through cryptic linkage disequilibrium with an allele of DRB1. Two non-shared epitope alleles were also strongly associated with RA (P<10(-4)): *0301 with anti- cyclic citrullinated peptide-negative RA and *0701 independently of autoantibody status. CONCLUSION: These results confirm the polygenic contribution of the MHC to RA and implicate 2 additional non-DRB1 susceptibility loci. The role of the HLA-DQ locus in RA has been a subject of controversy, but in our data, it appears to be spurious.
Altered expression of major histocompatibility complex (MHC) class I molecules can be caused by defects in genes of the antigen-processing machinery (APM), and is often correlated to progression in solid tumours. However, little is known about expression of the APM components in blasts from patients with acute myeloid leukaemia (AML). In this study, we investigated the expression of the APM components large multifunctional peptidases (LMP) 2 and 7, transporter-associated with antigen processing (TAP) 1 and 2, beta-2-microglobulin (beta2m) and MHC class I heavy chain in situ by tissue microarray from bone marrow biopsies of 30 AML patients. APM components were heterogeneously expressed in all AML samples tested, but no significant correlation with the AML subtype according to the French-American-British classification was found. Depending on the APM component tested, up to 90% of the trephines showed no or weak expression, whereas the LMP7 protein was detected in 66% of all samples. By following disease progression in individual AML patients, we found severe downregulation of APM components in two out of four patients from initial diagnosis to relapse. We conclude that downregulation of APM components may play a role in the failure of immuno-surveillance and may therefore contribute to relapse in acute leukaemia.
PURPOSE: The transporter associated with antigen processing (TAP) is essential in assembling MHC-I proteins. Human papillomavirus (HPV) evades immune recognition by decreasing class I MHC cell surface expression through down-regulation of TAP1 levels. Consistent with heterogeneity in MHC expression is the individual variability in clearing detectable HPV infections. Genetic polymorphisms in TAP genes may affect protein structure, function, and the ability to clear HPV infection. EXPERIMENTAL DESIGN: Case-control study of women with cervical intraepithelial neoplasia (CIN) II or III (n = 114) and women without high-grade CIN (n = 366). Five nonsynonymous single nucleotide polymorphisms (SNP) in TAP1 and TAP2 were genotyped using DNA collected in cervicovaginal lavage samples using microsphere array technology (Luminex xMAP). HPV typing was done using a PCR-based system with MY09/MY11 primers. TAP1 and TAP2 SNPs were validated by direct sequencing. RESULTS: Differences in allele distribution between women with high-grade cervical neoplasia and women without was seen for TAP1 I333V (P = 0.02) and TAP1 D637G (P = 0.01). The odds ratios (OR) for CIN III were significantly lower among carriers of the TAP1 I333V polymorphism (OR, 0.28; 95% confidence interval, 0.1-0.8), and TAP1 D637G polymorphism (OR, 0.27; 95% confidence interval, 0.1-0.7). These associations remained significant even after restricting the evaluation to women who were positive for high-risk HPV types. CONCLUSIONS: In addition to the down-regulation of MHC-1 by oncogenic HPV, HPV pathogenesis might be facilitated by polymorphisms in the TAP proteins. Identifying TAP polymorphisms may potentially be used to identify women less susceptible to progression to high-grade CIN and cervical cancer.
Genetic variation of the antigen processing machinery (APM) components TAP2, LMP7, and ERAP1 is related to cervical carcinoma risk, although the relation with expression and clinical outcome remains unknown. We have investigated the occurrence of APM component single nucleotide polymorphisms (SNPs) in cervical carcinoma. Twelve nonsynonymous, coding SNPs in the TAP1, TAP2, LMP2, LMP7, and ERAP1 genes were genotyped in 75 cervical carcinoma patients with known APM component and HLA class I expression levels. Individual genotype distributions were assessed for association with APM component expression, various histopathological parameters and survival. Genotype distributions at the ERAP1-56 and ERAP1-127 loci were significantly associated with overall survival (OS); haplotype construction spanning these two SNPs revealed that the combination of a major allele at ERAP1-56 and a minor allele at ERAP1-127 was significantly associated with survival, homozygosity for this haplotype being associated with decreased OS (5-year survival 50% vs. 70 and 81% for complete absence or heterozygosity for this haplotype, respectively; P = 0.021). Heterozygosity for this haplotype was an independent predictor for better OS in multivariate analysis (HR = 0.219; P = 0.014). These data indicate that genetic variation in APM component genes, particularly ERAP1, is an important contributing factor in cervical carcinogenesis, progressive tumor growth and survival. The location of the ERAP1-127 SNP in the peptidase M1 domain of the ERAP1 aminopeptidase suggests the possibility of direct functional consequences of variation at this locus.
Schizophrenia is a mind-destructive disease. Family and twin studies have indicated an equal contribution of genetic endowment and environmental factors in the pathogenesis of schizophrenia. Recently Chlamydiaceae species has been identified as a major factor in the pathogenesis of schizophrenia, suggesting defective immune responses of schizophrenic patients against this environmental factor. Immune responses against Chlamydiaceae species are controlled by immunogenetic factors. Successful responses against microbes depend on the presentation of immunogenic peptides by HLA molecules, which are encoded by a highly polymorphic gene system. Until now several HLA alleles or HLA antigens have been found associated with schizophrenia by some researchers but not by others. This could be explained by failing immune responses against different microbes or different immune responses against the same microbe. Another explanation, not contradictory rather supplementary, is the participation of non-classical HLA genes in the immune response and thus in the disease development. Variants of these genes, i.e. alleles, which control transportation and loading of microbial peptides onto HLA molecules, could prevent clearing of immune cell infection by selection of non-immunogenic peptides for HLA presentation. To generate support for our hypothesis we determined in a small group of schizophrenic patients and control individuals allele frequencies of the transporter proteins TAP1/TAP2, which select the immunoproteasome-tailored peptides for transportation. We determined also frequencies of TAPASIN alleles, which encode chaperons and also may select peptides for loading on MHC molecules. Our pilot study included 20 patients and 162 control individuals. We found significant associations between schizophrenia and TAP1 allele frequencies (P=9.95x10(-3), chi(2)=12.36) as well as TAPASIN allele frequencies (P=2.8x10(-2), chi(2)=5.3). This suggests that variants of these two genetic systems could influence the disease process of schizophrenia. Furthermore, these genes belong to the family of ABC transporter proteins and may also influence the efficiency of drugs and thus of therapeutic modalities. Our investigations require certainly larger patient panels to prove our hypothesis and our results to be correct.
Prematurity is a risk factor for severe respiratory syncytial virus bronchiolitis. We show that genetic factors in innate immune genes (IFNA13, IFNAR2, STAT2, IL27, NFKBIA, C3, IL1RN, TLR5), in innate and adaptive immunity (IFNG), and in airway remodeling genes (ADAM33 and TGFBR1), affect disease susceptibility to a different extent in preterm children, born with underdeveloped lungs, than in term children.
BACKGROUND: Transporter associated with antigen processing (TAP), a member of the ATP-binding cassette transporter super family, is composed of two integral membrane proteins, TAP-1 and TAP-2. The TAP gene product is involved in the processing of endogenous peptides that bind to MHC class I molecules. Mutations and/or polymorphism within these genes could alter the efficacy of the immune response which might be relevant for the development of autoimmune diseases and cancer. METHODS: DNA was isolated from peripheral blood sample of 200 patients with cervical cancer and 200 healthy controls. TAP1 and TAP2 allele polymorphism were determined by polymerase chain reaction. RESULT: Significant protective OR (OR = 0.22 95% CI = 0.09-0.51, P < 0.001-OR = 0.47, 95% CI = 0.24-0.92, P = 0.02) was observed for GG and combined AG+GG genotypes of TAP2 in patients with SCC respectively. Similarly, such genotypes (GG, AG+GG) appeared same OR for patient with cervical cancer in study group (OR = 0.12, 95% CI = 0.04-0.39-P < 0.001-OR = 0.5 ,95% CI = 0.25-0.95-P = 0.03). There was decrease risk of cervical cancer in user of oral contraceptive with AG and GG genotypes of TAP2 (OR = 0.55, 95% Cl = 0.41-0.73, P = 0.002, OR = 0.09, 95% CI = 0.02-0.36, P < 0.001) respectively. In case of TAP1 gene all allelic polymorphisms showed a decrease OR in patients with cervical cancer in passive smokers and user of oral contraceptives, though, no significant CONCLUSION: Thus, TAP1 and TAP2 genes polymorphism are not linked to cervical carcinoma, since no association was found between a particular genotype and the disease.
The transporter associated with antigen processing (TAP) represents a focal point in the immune recognition of virally or malignantly transformed cells by translocating proteasomal degradation products into the endoplasmic reticulum-lumen for loading of MHC class I molecules. Based on a number of experimental data and the homology to the bacterial ABC exporter Sav1866, we constructed a 3D structural model of the core TAP complex and used it to examine the interface between the transmembrane and nucleotide-binding domains (NBD) by cysteine-scanning and cross-linking approaches. Herein, we demonstrate the functional importance of the newly identified X-loop in the NBD in coupling substrate binding to downstream events in the transport cycle. We further verified domain swapping in a heterodimeric ABC half-transporter complex by cysteine cross-linking. Strikingly, either substrate binding or translocation can be blocked by cross-linking the X-loop to coupling helix 2 or 1, respectively. These results resolve the structural arrangement of the transmission interface and point to different functions of the cytosolic loops and coupling helices in substrate binding, signaling, and transport.
With dense single-nucleotide polymorphism (SNP) maps for 199 drug-related genes, we examined associations between 4190 SNPs and 38 commonly measured quantitative traits using data from 752 healthy Japanese subjects. On analysis, we observed a strong association between five SNPs within the uridine diphosphate glucuronosyltransferase 1A1 (UGT1A1) gene and serum total bilirubin levels (minimum P-value in Mann-Whitney test=1.82 x 10(10)). UGT1A1 catalyzes the conjugation of bilirubin with glucuronic acid, thus enhancing bilirubin elimination. This enzyme is known to play an important role in the variation of serum bilirubin levels. The five SNPs, including a nonsynonymous SNP-rs4148323 (211G>A or G71R variant allele known as UGT1A1*6)-showed strong linkage disequilibrium with each other. No other genes were clearly associated with serum total bilirubin levels. Results of linear multiple regression analysis on serum total bilirubin levels followed by analysis of variance showed that at least 13% of the variance in serum total bilirubin levels could be explained by three haplotype-tagging SNPs in the UGT1A1 gene.Journal of Human Genetics (2009) 54, 317-323; doi:10.1038/jhg.2009.31; published online 3 April 2009.
The ATP-binding cassette transporter (TAP) proteins are functionally relevant candidates for predisposition to systemic lupus erythematosus (SLE) by virtue of their role in autoantigen presentation and location in the major histocompatibility complex (MHC). We tested if variation in the TAP genes (TAP1 and TAP2) is associated with SLE. We genotyped tag single nucleotide polymorphisms (SNPs) and performed family-based association analysis on 390 Caucasian pedigrees. We found significant evidence of association between TAP2 and SLE (rs241453, P=1.33 x 10(-6)). Conditional logistic regression analysis suggests that this TAP2 effect is separate from the HLA-DRB1 alleles. Our analyses show that both rs241453 (P=1.6 x 10(-4)) and HLA-DRB1*03xx (P=2.3 x 10(-4)) have significant autonomous effects not due to linkage disequilibrium. Moreover, these loci exhibit a significant statistical interaction (P<1.0 x 10(-6)), demonstrated by an increase in the odds ratio for the TAP2 association from OR=2.00 (95% confidence interval (CI)=1.17-3.42) in HLA-DRB1*03xx-negative subjects to OR=4.29 (CI=1.88-9.76) in the subjects with at least one HLA-DRB1*03xx allele group. We report the largest association study of the TAP genes with SLE to date, and the first to test for its separate effect and interaction with the HLA alleles consistently associated with SLE.
OBJECTIVE: Alterations in antigen processing have been proposed to play a significant role in the pathogenesis of ankylosing spondylitis (AS). A non-major histocompatibility complex gene encoding an endoplasmic reticulum aminopeptidase, ERAP1, has been implicated recently. This study assessed 13 coding single-nucleotide polymorphisms (SNPs) from 5 genes involved in antigen processing (ERAP1, TAP1, TAP2, LMP2, and LMP7) in 3 Canadian cohorts of patients with AS, to address the possibility of gene interactions in disease susceptibility. METHODS: The study involved 992 AS cases and 1,437 controls from 3 centers (472 cases and 451 controls from Alberta, 138 cases and 392 controls from Newfoundland, and 382 cases and 594 controls from Toronto). Most of the patients with AS and healthy, unrelated controls were Caucasians of northern European descent. Single-marker and haplotype associations were determined using an allelic likelihood ratio test in UNPHASED, version 3.0.12, and the WHAP program, respectively. P values for significance of haplotype associations were calculated using a permutation test. RESULTS: A specific ERAP1 haplotype, rs27044/10050860/30187-CCT, was strongly associated with increased risk of AS in all 3 case-control cohorts (pooled odds ratio [OR] 1.81, 95% confidence interval [95% CI] 1.46-2.24; P=7x10(-8)), while a second specific ERAP1 haplotype, rs30187/26618/26653-CTG, reduced the disease risk (pooled OR 0.77, 95% CI 0.67-0.88; P=9x10(-5)). Significant associations were also noted for 3 ERAP1 SNP variants (rs10050860, rs30187, and rs26653), although no significant haplotype interaction between ERAP1 and TAP/LMP loci was evident. CONCLUSION: These data indicate that an AS disease locus may reside on a specific ERAP1 haplotype, and its effect is not multiplicative with contributions from TAP and LMP genes.
Human leukocyte antigen (HLA)-B27 is strongly associated with the autoimmune disease ankylosing spondylitis (AS). Other autoimmune disease-associated genes, such as transporter associated with antigen processing (TAP) genes, could also influence AS susceptibility. In this study, we investigated the association of TAP1 and TAP2 polymorphisms in genetically homogenous Chinese AS patients. Six TAP1 single nucleotide polymorphisms (SNPs) and three TAP2 SNPs sites were analyzed in B27-positive AS cases, healthy B27-negative controls, and healthy B27-positive controls. In the allele and genotype analysis, the results indicated that TAP1 site 1910 allele G, genotype AG and TAP2 site 1693 genotype AA were associated with increased AS risk in a case-B27 negative control (p < 0.05). In the haplotype analysis, TAP1 SNP haplotype (GGGGGG, TAP1*020101) and TAP1-TAP2 SNP haplotypes (GGGGGG-GGG, TAP1*020101-TAP2*0101, and GGAAGG-GAG, TAP1*0101-TAP2*0102) increased AS risk in case-B27 negative control (p < 0.05). In contrast, TAP1-TAP2 SNP haplotype GGGGGG-GAG (TAP1*020101-TAP2*0102) was less common in cases than in B27-negative controls (p < 0.05). Moreover, TAP1-TAP2 SNP haplotype GGGAGG-GGG (TAP1*0301-TAP2*0101) was less common in cases than in B27-positive controls. The two haplotypes appeared to confer protection in AS (p < 0.05). These results suggest a potential mechanism of altered antigen-peptide selection and transport in AS pathogenesis.
Information on protein localization on the subcellular level is important to map and characterize the proteome and to better understand cellular functions of proteins. Here we report on a pilot study of 466 proteins in three human cell lines aimed to allow large scale confocal microscopy analysis using protein-specific antibodies. Approximately 3000 high resolution images were generated, and more than 80% of the analyzed proteins could be classified in one or multiple subcellular compartment(s). The localizations of the proteins showed, in many cases, good agreement with the Gene Ontology localization prediction model. This is the first large scale antibody-based study to localize proteins into subcellular compartments using antibodies and confocal microscopy. The results suggest that this approach might be a valuable tool in conjunction with predictive models for protein localization.
BACKGROUND AND AIMS: The polymorphic transporter associated with antigen processing (TAP)1 and TAP2 genes encode subunits of the transporter that delivers peptides to the human leukocyte antigen class I molecules. Because the polymorphism of the TAP genes has been shown to affect peptide transport, it has been suggested that TAP genes are potential regulators of the immune response. We recently reported that TAP1 gene polymorphism is associated with severe dengue infection. This study was carried out to elucidate whether TAP2 polymorphisms are involved in diverse pathogenesis of dengue infection. MATERIALS AND METHODS: This study included 100 controls and 197 dengue-infected patients who were further categorized into 90 dengue fever (DF) cases, 75 dengue hemorrhagic fever cases (DHF), and 32 dengue shock syndrome (DSS) cases as per WHO grading system. TAP2 gene polymorphisms were determined by amplification refraction mutation system-polymerase chain reaction. RESULTS: The frequency of isoleucine at TAP2 379 (34.5%) was increased among DHF in comparison to controls (21%, P = 0.014). DHF cases were more likely to be heterozygous at TAP2 379 (50.7%) than controls [24%, odds ratio (OR) = 2.11, P = 0.001]. Significantly high proportion of DHF was found to have TAP2 665 threonine/alanine (THR/ALA) genotypes (30.7%) when compared with DF (13.3%, OR = 2.3, P = 0.006) cases. There was no difference in the genotypes studied between DSS and controls or DF or DHF. CONCLUSION: This first report on TAP 2 gene polymorphism in dengue suggested that heterozygous pattern at TAP2 379 locus confers susceptibility to DHF, and TAP2 665 THR/ALA genotype was found to be a risk factor for development of DHF.
BACKGROUND: Persistent infection with human papillomavirus type 16 (HPV16) is a primary etiological factor for the development of cervical cancer. Genes involved in antigen processing influence both the repertoire of antigens presented by HPV16-infected cells and the nature of HPV16-specific immune responses. Genetic variation in these genes may affect protein structure and function and, consequently, the ability of an individual to clear HPV infection. METHODS: Thirty-five single-nucleotide polymorphisms (SNPs) in 5 genes (LMP2, TAP1, LMP7, TAP2, and Tapasin) were investigated for association with susceptibility to HPV16-associated cervical cancer. Sequencing of these genes resulted in the discovery of 15 previously unreported SNPs. Microsphere-array flow cytometry-based genotyping was conducted on 787 samples from Hispanic and non-Hispanic white women (241 randomly selected control subjects, 205 HPV16-positive control subjects, and 341 HPV16-positive case subjects with cervical cancer). RESULTS: For 9 SNPs, 8 of which had not previously been reported in the context of cervical cancer, there were statistically significant differences between the genotype distribution in case subjects and that in control subjects. Haplotype analysis of 3 haplotype blocks revealed 3 haplotypes with significant differences in frequency in case-control comparisons. Both HPV16-specific and non-type-specific differences in genotype distribution were seen. CONCLUSIONS: Genes involved in antigen processing for HLA class I presentation may contribute to susceptibility to cervical cancer.
Recent evidence suggests that additional risk loci for RA are present in the major histocompatibility complex (MHC), independent of the class II HLA-DRB1 locus. We have now tested a total of 1,769 SNPs across 7.5Mb of the MHC located from 6p22.2 (26.03 Mb) to 6p21.32 (33.59 Mb) derived from the Illumina 550K Beadchip (Illumina, San Diego, CA, USA). For an initial analysis in the whole dataset (869 RA CCP + cases, 1,193 controls), the strongest association signal was observed in markers near the HLA-DRB1 locus, with additional evidence for association extending out into the Class I HLA region. To avoid confounding that may arise due to linkage disequilibrium with DRB1 alleles, we analyzed a subset of the data by matching cases and controls by DRB1 genotype (both alleles matched 1:1), yielding a set of 372 cases with 372 controls. This analysis revealed the presence of at least two regions of association with RA in the Class I region, independent of DRB1 genotype. SNP alleles found on the conserved A1-B8-DR3 (8.1) haplotype show the strongest evidence of positive association (P ~ 0.00005) clustered in the region around the HLA-C locus. In addition, we identified risk alleles that are not present on the 8.1 haplotype, with maximal association signals (P ~ 0.001-0.0027) located near the ZNF311 locus. This latter association is enriched in DRB1*0404 individuals. Finally, several additional association signals were found in the extreme centromeric portion of the MHC, in regions containing the DOB1, TAP2, DPB1, and COL11A2 genes. These data emphasize that further analysis of the MHC is likely to reveal genetic risk factors for rheumatoid arthritis that are independent of the DRB1 shared epitope alleles.
The transporter associated with antigen processing (TAP) is essential for peptide delivery from the cytosol into the lumen of the endoplasmic reticulum (ER), where these peptides are loaded on HLA I molecules. Our previous study found that expressions of TAP were reduced in human malignant melanoma (MM) lesions and associated with histopathologic characteristics. In this study, we further investigate expressions of TAP and HLA class I antigen in three human MM cell lines. pEGFP-TAP1/TAP2/TAP1+TAP2 were used to restore the expressions of TAP in the antigen presentation pathway-deficient MM cell line A375. TAP1- and TAP1+TAP2-transfected A375 increased TAP1, TAP2, and HLA class I antigen expression and antigen presentation. TAP1- and TAP1+TAP2-transfected A375 exhibited a dramatic increase in Melan-A-specific cytotoxic T lymphocytes (CTLs) compared with TAP2-transfected A375 or empty vector. These CTLs were capable of killing TAP1- and TAP1+TAP2-transfected A375. TAP1+TAP2-transfected A375 generated the highest frequency of Melan-A-specific IL-12 and interferon (IFN)-gamma-producing CD8+ T cells compared with TAP1, TAP2, and empty vector. Therefore, TAP expression restores both antigen presentation and immunogenicity in A375 melanoma cells and concomitantly increases IL-12 and IFN-gamma production in tumor antigen-specific CTLs; TAP should be considered as a part of the immunotherapies for MM.
Antigen peptides are actively transported across the endoplasmic reticulum by the transporters associated with antigen presentation (TAP). TAP genes polymorphism could influence the selection process that determines which antigen peptides play a role in the pathogenesis of dengue infection. The aim of this study was to investigate the association of TAP genes polymorphism in diverse pathogenesis of dengue infection. This study included 197 dengue-infected patients who were further categorized into 64, 23 and 11 primary dengue fever (DF), dengue hemorrhagic fever (DHF), dengue shock syndrome (DSS) cases, respectively and 26, 52, and 21 secondary DF, DHF and DSS cases, respectively as per WHO grading system. TAP1 and 2 gene polymorphisms were performed by the amplification refractory mutation system-polymerase chain reaction (ARMS-PCR). Analysis of TAP1 gene polymorphism demonstrated decreased frequency of Ile/Ile genotype at TAP1(333) in primary DHF cases (39.1%) when compared with primary DF (64.1%, P < 0.034, OR = 0.611).The genotype frequency of Val/Val at TAP2(379) locus was significantly decreased among primary DHF (43.5%) in comparison to primary DF (71.9%, P = 0.015, OR = 0.605). Significant low proportion of primary DSS were found to have TAP1(637) Asp/Asp genotypes (54.5%) when compared with primary DF (70.3%, P = 0.043). Asp/Asp genotype at TAP1(637) was found to reduce the risk by 0.643 times for primary DSS. There was no significant difference in the genotypes studied between primary and secondary infection and also within secondary dengue infection in all three clinical groups. This report on TAP gene polymorphisms in dengue suggested that among the primary-infected individuals, homozygous patterns for Ile at TAP1(333) Val at TAP2(379) loci and Asp at TAP1(637) were found to be a protective factor against development of DHF and DSS, respectively.
Cancer cells may evade immune surveillance as a result of defective antigen processing and presentation. In this study, we demonstrate that CD40 ligation overcomes this defect through the coordinated action of the transcription factors NF-kappaB and interferon regulatory factor 1 (IRF-1). We show that unlike interferon signaling, which triggers the STAT1-mediated transcriptional activation of IRF-1, the ligation of CD40 in carcinomas induces the rapid upregulation of IRF-1 in a STAT1-independent but NF-kappaB-dependent manner. The transcriptional activation of IRF-1 is controlled largely by the recruitment of p65 (RelA) NF-kappaB to the IRF-1 promoter following the engagement of a TAK1/IkappaB kinase beta/IkappaBalpha signaling pathway downstream of CD40. NF-kappaB and de novo-synthesized IRF-1 converge to regulate the expression of genes involved in antigen processing and transport, as evident from the sequential recruitment of NF-kappaB and IRF-1 to the promoters of the genes encoding transporter for antigen processing 1 (TAP1), TAP2, tapasin, and low-molecular-mass polypeptides LMP2 and LMP10. Moreover, the RNA interference-mediated knockdown of IRF-1 reduced, whereas the inhibition of NF-kappaB abolished, the effects of CD40 on TAP1 and LMP2 upregulation in carcinoma cells. Collectively, these data reveal a novel "feed-forward" mechanism induced by NF-kappaB which ensures that acutely synthesized IRF-1 operates in concert with NF-kappaB to amplify the immunoproteasome and antigen-processing functions of CD40.
The heterodimeric transporter associated with antigen processing (TAP) complex plays a key role in immune surveillance. TAP1 and TAP2 typing was usually performed by polymerase chain reaction (PCR)-restriction fragment length polymorphism and PCR-sequence-specific oligonucleotide probe. As an alternative to these methods, we have established TaqMan assays to determine the frequencies of the TAP1 and TAP2 alleles. We have used these new TaqMan assays to genotype the polymorphisms in 339 unrelated Chinese Hans residing in North and South China. We detected five TAP1 and four TAP2 alleles. All the loci conform to the Hardy-Weinberg expectations. The most frequent alleles in Chinese Hans were TAP1*0101 (79.79%) and TAP2*0101 (82.74%). The two-locus haplotype analysis showed highly significant positive linkage disequilibrium for one TAP1-TAP2 haplotype (TAP1*020101-TAP2*0102), three TAP1-DRB1 haplotypes (TAP1*020101-DRB1*03, TAP1*020102-DRB1*13, and TAP1*0301-DRB1*16), and three TAP2-DRB1 haplotypes (TAP2*0102-DRB1*09, TAP2*0103-DRB1*04, and TAP2*0201-DRB1*01). The three-locus haplotype analysis showed highly significant positive linkage disequilibrium for TAP1*0101-TAP2*0101-DRB1*07, TAP1*0101-TAP2*0103-DRB1*04, TAP1*020101-TAP2*0101-DRB1*03, and TAP1*020101-TAP2*0102-DRB1*13. Comparison of the allele frequencies with those of other populations showed that the TAP1 allele distribution was very similar in all the groups, except for the Guarani, Kaingang, and Anatolian populations, but TAP2 distribution was significantly different from that of the other populations. The new TaqMan method provides relatively accurate, high-resolution, simple, and fast assays for TAP genotyping.
Kawasaki disease is an acute, self-limited vasculitis of infants and children, manifest as fever and signs of mucocutaneous inflammation. Treatment with high-dose immunoglobulin reduces systemic inflammation and prevents coronary artery lesions in Kawasaki disease. In this study, we investigated the possible association of the major histocompatibililty complex (MHC) region for the susceptibility to Kawasaki disease using an MHC panel of 2360 single nucleotide polymorphism (SNP) markers. Analysis of data obtained from screening MHC-specific SNP chips with 48 case and 90 control subjects revealed five candidate loci with significance levels of uncorrected p < 0.01. However, only one candidate locus (HLA-G) was confirmed to have a significant association with Kawasaki disease (rs2523790, odds ratio [OR] = 3.00, 95% confidence interval [95% CI] = 1.14-7.91, uncorrected p = 0.0263) in the replication study using 44 new case subjects and the previous 90 controls. In the fine mapping of the HLA-G locus, in particular, a nonsynonymous SNP (C/A) of the HLA-G gene (rs12722477, Leu134Ile) was significantly associated with Kawasaki disease (OR = 3.23, 95% CI = 1.12-9.32). A subgroup analysis showed that this association was more apparent in patients with coronary artery aneurysms (OR = 4.02, 95% CI = 1.23-13.19). Therefore, our results indicate that HLA-G may play a crucial role for the susceptibility to Kawasaki disease.
Sporadic Alzheimer's disease (AD) appears to be the consequence of the interaction between combinations of genes and environmental factors. Binding with the transporter associated with antigen processing (TAP) is thought to be the main way in which herpes simplex virus type 1 (HSV-1) evades immune surveillance. Several TAP gene polymorphisms were examined and a TAP2 SNP (rs241448) associated with AD found in two independent case-control samples, especially in carriers of the APOE4 allele. These findings are consistent with the hypothesis that human genetic variants facilitating the access of HSV-1 to the brain might result in susceptibility to AD.
The transporter 2, ATP-binding cassette, subfamily B (TAP2) is involved in the transport of antigenic peptides to HLA molecules. Coding TAP2 polymorphisms shows a strong association with type 1 diabetes, but it is not clear whether this association may be entirely due to linkage disequilibrium with HLA DR and DQ. Functionally, rat Tap2 nonsynonymous single-nucleotide polymorphisms (nsSNPs) confer differential selectivity for antigenic peptides, but this was not shown to be the case for human TAP2 nsSNPs. In the human, differential peptide selectivity is rather conferred by two splicing isoforms with alternative carboxy terminals. Here, we tested the hypothesis that alleles at the coding SNPs favor different splicing isoforms, thus determining peptide selectivity indirectly. This may be the basis for independent contribution to the type 1 diabetes association. In RNA from heterozygous lymphoblastoid lines, we measured the relative abundance of each SNP haplotype in each isoform. In isoform NM_000544, the G (Ala) allele at 665 Thr>Ala (rs241447) is more than twice as abundant as A (Thr) (GA = 2.2 +/- 0.4, P = 1.5 x 10(-4)), while isoform NM_018833 is derived almost exclusively from chromosomes carrying A (AG = 18.1 +/- 5.6, P = 2.04 x 10(-7)). In 889 Canadian children with type 1 diabetes, differential transmission of parental TAP2 alleles persisted (P = 0.011) when analysis was confined to chromosomes carrying only DQ*02 alleles, which mark a conserved DR-DQ haplotype, thus eliminating most of the variation at DR-DQ. Thus, we present evidence of TAP2 association with type 1 diabetes that is independent of HLA DR-DQ and describe a plausible functional mechanism based on allele dependence of splicing into isoforms known to have differential peptide selectivities.
Bronchiectasis is characterized by permanent changes in the structure and function of the airways. Its cause cannot be identified in some cases. A genetic disease can predispose to bronchiectasis in our country, where consanguinity of parents is common. Transporter associated with antigen presentation (TAP) deficiency syndrome is characterized by recurrent bacterial lower respiratory tract infections, which cause bronchiectasis. Our aim was to document the relationship between idiopathic bronchiectasis and TAP gene polymorphisms. Forty-four patients with idiopathic bronchiectasis and 100 healthy individuals as the control group were included. DNA was extracted and gene polymorphisms for TAP1 and TAP2 were studied. When compared to healthy controls, in the patient group, Ile/Ile genotype was decreased and Ile/Val genotype was increased in TAP1-333 polymorphism analysis; Asp/Asp and Gly/Gly genotypes were decreased and Asp/Gly frequency was increased in TAP1-637 polymorphism analysis; Ile/Val genotype was increased and Ile/Ile genotype was decreased in TAP2-379 polymorphism analysis; and Thr/Thr genotype frequency was decreased and Thr/Ala and Ala/Ala genotypes were increased in TAP2-665 polymorphism analysis. No statistically significant difference between patient and control groups was noted only in TAP2-565 polymorphism analysis. These results indicate that TAP gene polymorphisms may have had a role in the development of bronchiectasis in our patient group. Therefore, TAP deficiency syndrome should be considered in children with idiopathic diagnosis, since early diagnosis of the disease will improve life quality and survival.
Despite the availability of effective vaccines, hepatitis B virus (HBV) infection is still commonly seen worldwide. Several reports show that the human major histocompatibility complex (MHC) systems were involved in the elimination of HBV via the restrictive antigen-processing pathway. We investigate whether LMP/TAP gene polymorphisms coded by MHC-II region were associated with HBV infection. A total of seven polymorphisms of LMP/TAP gene were identified by polymerase chain reaction (PCR) restriction fragment length polymorphism (RFLP) assays. Three hundred fifty-six patients and 326 unrelated healthy volunteers were included in the case-control study. Of the seven polymorphisms, three of which (LMP7 codons 145, TAP1 codons 637, and TAP2 codons 651) were observed to have statistically significant association with HBV infection (P < 0.05). We analyzed the three-locus haplotype constructed with three such polymorphisms and found that the frequency of haplotypes D and E increased significantly in patients, in comparison with that in controls (OR = 3.57, 95% CI: 2.09-6.12, P < 0.001; OR = 2.74, 95% CI: 1.35-5.56, P = 0.005, respectively). The results imply that LMP7-145, TAP1-637, and TAP2-651 sites were associated with the risk of HBV infection. Haplotypes D and E might be involved in the development of HBV infection. These data suggest a potential role of LMP/TAP gene as a candidate gene for susceptibility to HBV infection.
Psoriasis, a skin disease with autoimmune features, can be triggered and exacerbated by genetic and environmental factors. Chemicals can break tolerance to self-antigens by interfering with antigen processing and presentation; therefore, proteins involved in antigen processing may affect susceptibility. We test here whether variants of immunoproteasome subunits LMP2 and LMP7, or antigen peptide transport proteins TAP1 (transporters associated with antigen presentation) and TAP2 are associated with psoriasis. We analyzed 7 single-nucleotide polymorphisms in 321 Caucasian (German) psoriasis patients and 235 unrelated controls by time-of-flight mass spectrometry, using the Sequenom platform. We found strong associations of psoriasis with variant alleles of LMP and TAP (OR(TAP_687): 3.3, 95% CI: 1.9-5.7). Genotype effects were generally stronger for males and LMP effects were mainly seen for psoriasis arthropathica. Our results will help define behavioral or drug treatment suggestions to patients and contribute to a better understanding of the role of low molecular weight chemicals in genetic susceptibility to autoimmune diseases.
BACKGROUND: Respiratory syncytial virus (RSV) is a common cause of severe lower respiratory tract infection in infants. Only a proportion of children infected with RSV require hospitalization. Because known risk factors for severe disease, such as premature birth, cannot fully explain differences in disease severity, genetic factors have been implicated. METHODS: To study the complexity of RSV susceptibility and to identify the genes and biological pathways involved in its development, we performed a genetic association study involving 470 children hospitalized for RSV bronchiolitis, their parents, and 1008 random, population controls. We analyzed 384 single-nucleotide polymorphisms (SNPs) in 220 candidate genes involved in airway mucosal responses, innate immunity, chemotaxis, adaptive immunity, and allergic asthma. RESULTS: SNPs in the innate immune genes VDR (rs10735810; P=.0017), JUN (rs11688; P=.0093), IFNA5 (rs10757212; P=.0093), and NOS2 (rs1060826; P=.0031) demonstrated the strongest association with bronchiolitis. Apart from association at the allele level, these 4 SNPs also demonstrated association at the genotype level (P=.0056, P=.0285, P=.0372, and P=.0117 for the SNPs in VDR, JUN, IFNA5, and NOS2, respectively). The role of innate immunity as a process was reinforced by association of the whole group of innate immune SNPs when the global test for groups of genes was applied (P=.046). CONCLUSION: SNPs in innate immune genes are important in determining susceptibility to RSV bronchiolitis.
Tapasin organizes the peptide-loading complex (PLC) by recruiting peptide-receptive MHC class I (MHC-I) and accessory chaperones to the N-terminal regions of the TAP subunits TAP1 and TAP2. Despite numerous studies have shown that the formation of the PLC is essential to facilitate proper MHC-I loading, the molecular architecture of this complex is still highly controversial. We studied the stoichiometry of the PLC by blue native-PAGE in combination with Ab-shift assays and found that TAP/tapasin complexes exist at steady state as a mixture of two distinct oligomers of 350 and 450 kDa. Only the higher m.w. complex contains MHC-I and disulfide-linked tapasin/ER60 conjugates. Moreover, we show for the first time to our knowledge that the fully assembled PLC comprises two tapasin, two ER60, but only one complex of MHC-I and calreticulin. Based hereon we postulate that the TAP subunits alternate in the recruitment and loading of a single MHC-I.
Antigen peptides are actively transported across the endoplasmic reticulum by the transporters associated with antigen presentation (TAP). TAP genes polymorphism could influence the selection process that determines which antigen peptides play a role in the pathogenesis of allergic rhinitis. The aim of this study was to investigate the association of TAP genes polymorphism with allergic rhinitis. TAP1 and TAP2 genotyping were performed on 110 allergic rhinitis patients and 107 healthy controls. TAP1 polymorphic residues at codons 333 and 637, and TAP2 polymorphic residues at codons 379, 565, 651, and 665 were analyzed by the amplification refractory mutation system-polymerase chain reaction (ARMS-PCR). Analysis of TAP1 gene polymorphism demonstrated decreased frequencies of Ile/Val genotype at codon 333, Asp/Gly genotype at codon 637, and haplotype A and B in allergic rhinitis patients when compared to controls (p<0.05). However, there was no significant difference in the genotype, phenotype, or allele frequencies at four TAP2 codons between controls and allergic rhinitis patients. In conclusion, TAP1 gene polymorphism may be an important factor contributing to the genetic susceptibility in the development of allergic rhinitis in the Korean population.
The endoplasmic reticulum-resident human cytomegalovirus glycoprotein US6 (gpUS6) inhibits peptide translocation by the transporter associated with antigen processing (TAP) to prevent loading of major histocompatibility complex class I molecules and antigen presentation to CD8+ T cells. TAP is formed by two subunits, TAP1 and TAP2, each containing one multispanning transmembrane domain (TMD) and a cytosolic nucleotide binding domain. Here we reported that the blockade of TAP by gpUS6 is species-restricted, i.e. gpUS6 inhibits human TAP but not rat TAP. Co-expression of human and rat subunits of TAP demonstrates independent binding of gpUS6 to human TAP1 and TAP2, whereas gpUS6 does not bind to rat TAP subunits. gpUS6 associates with preformed TAP1/2 heterodimers but not with unassembled TAP subunits. To locate domains of TAP required for gpUS6 binding and function, we took advantage of reciprocal human/rat intrachain TAP chimeras. Each TAP subunit forms two contact sites within its TMD interacting with gpUS6. The dominant gpUS6-binding site on TAP2 maps to an N-terminal loop, whereas inhibition of peptide transport is mediated by a C-terminal loop of the TMD. For TAP1, two gpUS6 binding domains are formed by loops of the C-terminal TMD. The domain required for TAP inactivation is built by a distal loop of the C-terminal TMD, indicating a topology of TAP1 comprising 10 endoplasmic reticulum transmembrane segments. By forming multimeric complexes, gpUS6 reaches the distant target domains to arrest peptide transport. The data revealed a nonanalogous multipolar bridging of the TAP TMDs by gpUS6.
The comparative study of the human and chimpanzee genomes may shed light on the genetic ingredients for the evolution of the unique traits of humans. Here, we present a simple procedure to identify human-specific nonsense mutations that might have arisen since the human-chimpanzee divergence. The procedure involves collecting orthologous sequences in which a stop codon of the human sequence is aligned to a non-stop codon in the chimpanzee sequence and verifying that the latter is ancestral by finding homologs in other species without a stop codon. Using this procedure, we identify nine genes (CML2, FLJ14640, MT1L, NPPA, PDE3B, SERPINA13, TAP2, UIP1, and ZNF277) that would produce human-specific truncated proteins resulting in a loss or modification of the function. The premature terminations of CML2, MT1L, and SERPINA13 genes appear to abolish the original function of the encoded protein because the mutation removes a major part of the known active site in each case. The other six mutated genes are either known or presumed to produce functionally modified proteins. The mutations of five genes (CML2, FLJ14640, MT1L, NPPA, TAP2) are known or predicted to be polymorphic in humans. In these cases, the stop codon alleles are more prevalent than the ancestral allele, suggesting that the mutant alleles are approaching fixation since their emergence during the human evolution. The findings support the notion that functional modification or inactivation of genes by nonsense mutation is a part of the process of adaptive evolution and acquisition of species-specific features.
Genetic determinants of human susceptibility to tuberculosis (TB) have not been completely elucidated. Interleukin-1 beta (IL-1beta) and the inhibitor of kB-like (IkBL) are important molecules that participate in the inflammatory response required for the immunological control of a broad spectrum of infectious agents. The transporter associated with antigen processing (TAP) is involved in the antigen processing via major histocompatibility complex class I molecules and in turn might regulate the T-cell response against Mycobacterium tuberculosis. To better characterize the host genetic factors determining the susceptibility to TB, we evaluated the influence of functional polymorphisms in IL1B, TAP and IKBL genes on the risk of developing pulmonary TB in a Northwestern Colombian population, an endemic area of M. tuberculosis infection. A total of 122 TB patients and 166 healthy controls (N = 166) negative for human immunodeficiency virus infection were examined for IL1B-511 and +3,953, TAP1 and TAP2 and IKBL+738 polymorphisms. Univariate analysis disclosed significant differences between patients and controls for IL1B+3,953 polymorphism. After unconditional logistic regression analysis, a strong protection conferred by IL1B+3,953 T-allele-carrying genotypes was observed. A trend between TAP2*0201 allele and disease was observed. Association between IL1B-511, TAP1 or IKBL polymorphisms and TB disease was not found. These results indicate that a functional polymorphism in the IL1B gene influences the susceptibility to TB and suggest a role for IL-1beta in the pathogenesis of mycobacterial infection.
A total of 95 patients with active Graves' disease (GD) and 105 normal healthy subjects were enrolled in this study, which attempted to determine whether single-site polymorphisms of the transporter associated with antigen processing 2 (TAP2) gene contribute to an individual's susceptibility to GD. Such polymorphisms were detected using polymerase chain reaction (PCR)-based restriction analysis. Associations between GD and the three site polymorphisms of the TAP2 gene at codons 379, 565, and 665 were investigated. The results of the genotype analysis revealed that the frequency of the GG homozygote's presence at codon 665 was lower, and that of the AA homozygote's presence was greater in GD patients (15.8% and 36.8%, respectively) compared to normal controls (34.3% and 16.2%, respectively; P<0.001). The OR (OD) for the risk of occurrence for the AA homozygote and AG heterozygote compared to the GG homozygote (as was the case for the GD patients) was respectively 4.941 and 2.117, with respective 95% confidence intervals (CI) of 2.303-10.598 and 1.020-4.369. The allelic analysis also demonstrated reduced G and enhanced A allele frequencies for GD patients compared to controls (respectively 39.5% vs. 59.0% [G allele], and 60.5% vs. 41.0% [A allele]; P=0.0001; OR=2.219, 95% CI: 1.449-3.395). By contrast, the differences between patient and control groups for the frequency of appearance of genotypes and allelic variants at codon 379 (P=0.522 and P=0.306, respectively) and codon 565 (P=0.199 and P=0.157, respectively) did not appear to be significant. These data reveal that the single-site polymorphism of the TAP2 gene at codon 665 may be an indicator for predicting GD development.
BACKGROUND: A combination of interferon-alpha (IFN-alpha) and ribavirin has been the choice for treating chronic hepatitis C (CHC) patients. It achieves an overall sustained response rate of approximately 50%; however, the treatment takes 6-12 months and often brings significant adverse reactions to some patients. It would therefore be beneficial to include a pretreatment evaluation in order to maximize the efficacy. In addition to viral genotypes, we hypothesize that patient genotypes might also be useful for the prediction of treatment response. METHODS: We retrospectively analyzed the genetic differences of CHC patients that are associated with IFN/ribavirin responses. The DNA polymorphisms among 195 sustained responders and 122 nonresponders of CHC patients of Taiwanese origin were compared. Statistical and algorithmic methods were used to select the genes associated with drug response and single nucleotide polymorphisms (SNPs) that permitted the construction of a predictive model. RESULTS: Association studies and haplotype reconstruction revealed selection of seven genes: adenosine deaminase, RNA-specific (ADAR), caspase 5, apoptosis-related cysteine peptidase (CASP5), fibroblast growth factor 1 (FGF1), interferon consensus sequence binding protein 1 (ICSBP1), interferon-induced protein 44 (IFI44), transporter 2, ATP-binding cassette, subfamily B (TAP2) and transforming growth factor, beta receptor associated protein 1 (TGFBRAP1) for the responsiveness trait. Based on confirmed linkage disequilibrium block in the population, a minimal set of 26 SNPs in the seven selected genes was inferred. To predict treatment outcome, a multiple logistic regression model was constructed using susceptible genotypes of SNPs. The performance of the resultant model had a sensitivity of 68.2% and specificity of 60.7% on 317 CHC patients treated with IFN-combined therapy. In addition, a prediction model with both the host genetic and viral genotype information was also constructed which enhanced the performance with a sensitivity of 80.7% and specificity of 67.2%. CONCLUSIONS: A genetic model was constructed to predict outcomes of the combination therapy in CHC patients with high sensitivity and specificity. Results also provide a possible process of selecting targets for predicting treatment outcomes and the basis for developing pharmacogenetic tests.
The transporter associated with antigen processing (TAP), a member of the ATP binding cassette (ABC) family of transmembrane transporters, transports peptides across the endoplasmic reticulum membrane for assembly of major histocompatibility complex class I molecules. Two subunits, TAP1 and TAP2, are required for peptide transport, and ATP hydrolysis by TAP1.TAP2 complexes is important for transport activity. Two nucleotide binding sites are present in TAP1.TAP2 complexes. Compared with other ABC transporters, the first nucleotide binding site contains non-consensus catalytic site residues, including Asp(668) in the Walker B region of TAP1 (in place of a highly conserved glutamic acid), and Gln(701) in the switch region of TAP1 (in place of a highly conserved histidine). At the second nucleotide binding site, a glutamic acid (TAP2 Glu(632)) follows the Walker B motif, and the switch region contains a histidine (TAP2 His(661)). We found that alterations at Glu(632) and His(661) of TAP2 significantly reduced peptide translocation and/or TAP-induced major histocompatibility complex class I surface expression. Alterations of TAP1 Asp(668) alone or in combination with TAP1 Gln(701) had only small effects on TAP activity. Thus, the naturally occurring Asp(668) and Gln(701) alterations of TAP1 are likely to contribute to attenuated catalytic activity at the first nucleotide binding site (the TAP1 site) of TAP complexes. Due to its enhanced catalytic activity, the second nucleotide binding site (the TAP2 site) appears to be the main site driving peptide transport. A mechanistic model involving one main active site is likely to apply to other ABC transporters that have an asymmetric distribution of catalytic site residues within the two nucleotide binding sites.
The proteasome is a multi-protein complex that degrades cellular proteins as well as foreign proteins destined for antigen presentation. The latter function involves the immunoproteasome, in which several proteasome subunits are exchanged for gamma-interferon-induced subunits. The transporter associated with antigen processing (TAP) transports proteasome-generated peptides across the membrane of the endoplasmic reticulum (ER) prior to presentation on the plasma membrane. We demonstrate interactions between the cytoplasmic domains of TAP subunits and subunits of both the proteasome and the immunoproteasome, suggesting direct targeting of antigenic peptides to the ER via a TAP-proteasome association. We also show interaction between one of the cytoplasmic domains of P-glycoprotein and a proteasome subunit, but not the corresponding immunoproteasome subunit, suggesting a possible role for P-glycoprotein in the transport of proteasome-derived peptides.
TAP, an ABC transporter in the ER membrane, provides antigenic peptides derived from proteasomal degradation to MHC class I molecules for inspection by cytotoxic T lymphocytes at the cell surface so as to trace malignant or infected cells. To investigate the minimal number of transmembrane segments (TMs) required for assembly of the TAP complex based on hydrophobicity algorithms and alignments with other ABC transporters we generated N-terminal truncation variants of human TAP1 and TAP2. As a result, a 6+6 TM core-TAP complex represents the minimal functional unit of the transporter, which is essential and sufficient for heterodimer assembly, peptide binding, and peptide translocation into the ER. The TM1 of both, core-TAP1 and core-TAP2 are critical for heterodimerization of the complex.
We sought to determine whether transporter associated with antigen processing (TAP) gene polymorphism is associated with susceptibility to systemic sclerosis (SSc). TAP1 and TAP2 gene polymorphisms were analyzed in 61 Korean patients with SSc and 100 ethnically matched healthy Koreans by polymerase chain reaction-restriction fragment length polymorphism. Human leukocyte antigen (HLA)-DRB1 genotyping data of the patients from our previous study was used for the assessment of independent role of TAP genes to SSc susceptibility. Patients were stratified according to anti-topoisomerase I (anti-topo I) antibody status and clinical subsets of diffuse and limited cutaneous SSc (dcSSc and lcSSc). TAP1 and TAP2 gene polymorphisms were associated with different subsets of SSc: TAP1*A/A genotype with anti-topo I-positive dcSSc (p = 0.01, p corrected = 0.04), TAP2*A1/C genotype with anti-topo I-positive lcSSc (p < 0.05), TAP2*Bky2 and *C alleles with anti-topo I-negative dcSSc (both p < 0.05), and TAP2*B/E genotype with anti-topo I-negative lcSSc (p = 0.004). Although TAP gene associations were generally weak, some associations (TAP2*A1/C, TAP2*C, and TAP2*B/E) with different subsets of SSc were independent of HLA-DR associations, revealing even stronger associations (TAP2*A1/C and TAP2*C) among individuals not possessing the risk HLA-DR alleles. These results suggest the possible role of TAP gene polymorphisms in the genetic susceptibility to SSc.
Before exit from the endoplasmic reticulum (ER), MHC class I molecules transiently associate with the transporter associated with antigen processing (TAP1/TAP2) in an interaction that is bridged by tapasin. TAP1 and TAP2 belong to the ATP-binding cassette (ABC) transporter family, and are necessary and sufficient for peptide translocation across the ER membrane during loading of MHC class I molecules. Most ABC transporters comprise a transmembrane region with six membrane-spanning helices. TAP1 and TAP2, however, contain additional N-terminal sequences whose functions may be linked to interactions with tapasin and MHC class I molecules. Upon expression and purification of human TAP1/TAP2 complexes from insect cells, proteolytic fragments were identified that result from cleavage at residues 131 and 88 of TAP1 and TAP2, respectively. N-Terminally truncated TAP variants lacking these segments retained the ability to bind peptide and nucleotide substrates at a level comparable to that of wild-type TAP. The truncated constructs were also capable of peptide translocation in vitro, although with reduced efficiency. In an insect cell-based assay that reconstituted the class I loading pathway, the truncated TAP variants promoted HLA-B*2705 processing to similar levels as wild-type TAP. However, correlating with the observed reduction in tapasin binding, the tapasin-mediated increase in processing of HLA-B*2705 and HLA-B*4402 was lower for the truncated TAP constructs relative to the wild type. Together, these studies indicate that N-terminal domains of TAP1 and TAP2 are important for tapasin binding and for optimal peptide loading onto MHC class I molecules.
To analyze the polymorphism of TAP gene and the shared rates of alleles between mothers and their infants in Chinese patients with pre-eclampsia, TAP1 and TAP2 genotyping was performed by the amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) in 42 patients, 106 normal pregnant women, and their neonates. The allelic frequency of TAP and the alleles shared in maternal-fetus were compared and analyzed in the two groups. Our results showed that, with totally eight alleles of TAP1 and TAP2 examined in the samples, no significant difference was found in allelic frequencies between pre-eclampsia group and control group, as well as between mothers and their neonates. Similar finding was obtained in the comparison with shared alleles. In conclusion, our results do not support a role for the polymorphisms of TAP in the etiology of pre-eclampsia.
The transporter associated with Ag processing (TAP) translocates antigenic peptides into the endoplasmic reticulum for binding onto MHC class I (MHC I) molecules. Tapasin organizes a peptide-loading complex (PLC) by recruiting MHC I and accessory chaperones to the N-terminal regions (N domains) of the TAP subunits TAP1 and TAP2. To investigate the function of the tapasin-docking sites of TAP in MHC I processing, we expressed N-terminally truncated variants of TAP1 and TAP2 in combination with wild-type chains, as fusion proteins or as single subunits. Strikingly, TAP variants lacking the N domain in TAP2, but not in TAP1, build PLCs that fail to generate stable MHC I-peptide complexes. This correlates with a substantially reduced recruitment of accessory chaperones into the PLC demonstrating their important role in the quality control of MHC I loading. However, stable surface expression of MHC I can be rescued in post-endoplasmic reticulum compartments by a proprotein convertase-dependent mechanism.
INTRODUCTION: Inflammation might be one of the causes of stone disease. The function of the transporter associated with antigen-processing protein (TAP) is related to immune response and inflammation. Our aim was to investigate the relationship between stone disease and 5 polymorphic sites of the TAP gene (TAP1-1, 1-2, 2-1, 2-2, 2-3). MATERIALS AND METHODS: We compared the frequencies of 5 polymorphisms in the TAP gene between 208 patients with recurrent calcium oxalate stone and 210 healthy controls. The polymorphism was detected by polymerase chain reaction-based restriction analysis. RESULTS: Significant differences in the frequency of the polymorphism at the TAP2-2 site were detected between normal individuals and calcium stone disease patients (p<0.0001). The distribution of the genotype AA homozygote was higher in stone patients (33.3%) than in the control group (16.3%). The odds ratio for the A allele compared with the G allele was 2.097 (95% CI 1.571-2.802). CONCLUSIONS: We conclude that the TAP2-2 MspI polymorphism might be associated with calcium stone disease.
Transporter associated with antigen processing (TAP) molecules are involved in the processing of endogenous peptides that bind to major histocompatibility complex (MHC) class I molecules. The possible functional significance of TAP polymorphisms for antigenic peptide transport is an unresolved issue. Population genetics is a tool for investigating the evolutionary and functional significance of genetic polymorphisms. We studied 105 unrelated individuals from Eastern Andalusia in Southern Spain for TAP1 and TAP2 polymorphisms and to detect linkage disequilibrium between TAP1 and TAP2 and between TAP1/TAP2 and human lymphocyte antigen (HLA) DR, DP, and DQ genes. HLA-DR, -DQ, -DP, and TAP1 loci were genotyped with the polymerase chain reaction (PCR)-sequence-specific oligonucleotide method, and TAP2 genes were typed by using the amplification-refractory mutation system-PCR technique. The alleles TAP1*D (3.3%), TAP2*D (2.4%), and TAP2*E (2.9%) were present in the Eastern Andalusian population but not in the general Spanish population. No evidence of linkage disequilibrium was found between TAP1 and TAP2 or between the TAP genes and HLA-DR, -DP, and -DQ in the Eastern Andalusian population. These results are consistent with the absence of coevolution between TAP and MHC class II genes and the hypothesis of selective neutrality.
Pemphigus vulgaris (PV) is a human leukocute antigen (HLA) class II-associated autoimmune disease of the skin of unknown etiology. We recently described the association of pemphigus vulgaris with two clusters of microsatellite loci within the major histocompatibility complex region. One cluster includes the microsatellite marker TAP1CA, located in proximity to the transporter associated with antigen processing (TAP) genes. These genes are essential for class I antigen processing machinery and could be an additional set of genes involved in susceptibility to PV. The aim of this study was to investigate a possible association between TAP gene polymorphisms and PV. For this purpose we examined 37 unrelated Jewish Israeli patients with PV and compared them with 37 healthy Israeli Jewish HLA-matched controls. Significant differences were detected in TAP2 amino acid residues (p=0.001). Two PV TAP2 risk alleles were identified (TAP2*C and TAP2*D), the frequency of which was estimated to be 37.8% in the patients and 5.3 % in the controls. This association was found to be independent of HLA-DR. It is therefore likely that TAP2 genes are involved in susceptibility to development of PV.
Ligand binding grooves of MHC class I molecules are able to load a panel of endogenous peptides of varying length and sequence derived from self or foreign origin to activate or deactivate cytotoxic CD8(+) T cells. Peptides are assembled with class I molecules by pathways that are either dependent or independent of transport by ABC proteins (TAP) and degradation in the immunoproteasome by its subunits LMP2 and LMP7. Those peptides that require TAP and LMP treatment appear to be subject to control and optimization by TAP for proper customizing and efficient presentation. Therefore, allelic variations in the coding sequences of TAP and LMP were suspected for a long time to be responsible for improper antigen processing, interruption of self-peptide presentation and reduced cell surface expression of MHC class I molecules resulting in the activation of autoreactive CD8(+) T cells. In this article we reviewed the controversial findings regarding the role of TAP and LMP genes in autoimmune diabetes and reevaluated data of eleven separate studies in a cross-study analysis by genotype and HLA haplotype matching. We could confirm previous results by showing that TAP2*651-A/F and TAP2*687-A/A are significantly associated with disease, independently of linkage disequilibrium (LD). LMP2-R/H surprisingly seems to be primarily disease-conferring although a weak association with DR4 serotypes can be observed. Our analysis also suggests that LMP7-B/B, TAP1-A/A and TAP2*687-A/B are the protective genotypes and that these associations are not secondary to LD with DRB1. Consequently, intracellular antigen processing associated with TAP- and proteasome-dependent pathways seems to be a critical element in T cell selection for the retention of a balanced immunity.
The transporter associated with antigen processing (TAP1/2) translocates cytosolic peptides of proteasomal degradation into the endoplasmic reticulum (ER) lumen. A peptide-loading complex of tapasin, major histocompatibility complex class I, and several auxiliary factors is assembled at the transporter to optimize antigen display to cytotoxic T-lymphocytes at the cell surface. The heterodimeric TAP complex has unique N-terminal domains in addition to a 6 + 6-transmembrane segment core common to most ABC transporters. Here we provide direct evidence that this core TAP complex is sufficient for (i) ER targeting, (ii) heterodimeric assembly within the ER membrane, (iii) peptide binding, (iv) peptide transport, and (v) specific inhibition by the herpes simplex virus protein ICP47 and the human cytomegalovirus protein US6. We show for the first time that the translocation pore of the transporter is composed of the predicted TM-(5-10) of TAP1 and TM-(4-9) of TAP2. Moreover, we demonstrate that the N-terminal domains of TAP1 and TAP2 are essential for recruitment of tapasin, consequently mediating assembly of the macromolecular peptide-loading complex.
The aim of this study was to investigate the association between the polymorphism of transporters associated with antigen processing ( TAP1/TAP2) genes and rheumatoid arthritis in Chinese patients. A total of 100 RA patients and 99 healthy control subjects were enrolled. Analyses with polymerase chain reaction (PCR) based restrictions were used to identify the polymorphisms of the TAP1 and TAP2 genes, which were mapped on chromosome 6. There was a significant difference in the distribution of the TAP2 gene codon 565 polymorphism frequency between the RA patients and healthy control subjects ( p<0.001). The odds ratio for the risk of the 'A' allele in RA patients was 1.60 (95% CI: 0.82-2.92). No statistical associations in the distribution of the TAP1 gene polymorphism frequency were found between RA patients and controls. There were some physical links found between TAP1/TAP2 gene polymorphism loci. However, there was no linkage observed from TAP1/TAP2 gene polymorphisms and HLA-DRB1*04 between RA patients and healthy controls. We concluded that the TAP2 gene codon 565 'A' allele was associated with RA in Chinese patients in Taiwan. Individuals possessing the 'A' allele had a higher incidence of RA. A lack of association of TAP1 gene polymorphisms between RA patients and healthy individuals was noted. The results of this study provide genetic evidence that TAP2 gene codon 565 polymorphism may play a role in RA.
OBJECTIVES: Polymorphisms of transporters associated with antigen-processing (TAP) genes might influence the susceptibility to schizophrenia by altering the antigen-processing pathway. The aim of this study was to verify the relationship between schizophrenia and the polymorphisms of TAP2 genes. METHOD: Two hundred and fifty-seven Korean patients diagnosed with schizophrenia according to DSM-IV and 184 normal controls participated in this study. TAP2 polymorphic residues at positions 379, 565 and 665 were typed using amplification refractory mutation system-polymerase chain reaction single-strand conformation polymorphism. RESULTS: Distribution of the alleles and genotypes in patients with schizophrenia was not significantly different from those of controls. CONCLUSIONS: This study did not show the association of the TAP2 gene with schizophrenia in the Korean population.
In this study, we have investigated the frequencies of TAP1 and TAP2 alleles in a group of 226 persons, living in La Reunion Island, consisting of 70 patients with insulin-dependent diabetes mellitus (IDDM) and most of their first degree relatives (i.e., 156 parents and full sibling subjects) and previously HLA DQB1, DQA1, and DRB1 genotyped. The population of this island is constituted by a particular structure of highly crossbreeding people. Interestingly, the new TAP2*0104 allele, previously discovered by our team in Reunion Island, was found to be increased in the IDDM population and the calculated HRR was relatively high (HRR = 3.3). This result seems to be due to a positive linkage disequilibrium between TAP2*0104 allele and the highly diabetogenous DQB1* 0201-DQA1* 0501-DRB1 0301 haplotype (HRR = 9), which suggests that TAP2*0104 cannot be considered as an additional predispositional factor, but more as a genetic susceptibility marker of IDDM. In addition, we show that minor alleles (TAP2D, *0102, *0103, *0104) are associated with a restricted number of HLA DQ-DR haplotypes and each of them exhibits a preferential linkage with one particular haplotype. In contrast with other alleles, and despite a HRR value close to 1, we show that TAP2*0102 allele contributes significantly to a drastic reduction of the diabetogenic effect of DQB1*0201-DQA1*0301.1-DRB*0701 haplotype. Indeed, this haplotype, which is usually preferentially transmitted to affected children, is dominantly transmitted to healthy children when it is associated with TAP2*0102. Therefore, this allele seems to contribute to genetic protection to IDDM.
Resource Links
Contents
- Gene Summary
- Orthologs and Paralogs
- Antibodies
- Exon, Intron and UTRs
- CpG near TSS
- Gene Classification
- RefSeq Isoforms
- MicroRNA and Targets
- Transcript Sequences
- Protein Sequences
- Mutations and SNPs
- Phenotypes
- Chemicals and Drugs
- Gene and Diseases
- Gene Interactions
- Transcript Cluster
- Selected Publications

