TAP2 | GeneID:6891 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 6891 Official Symbol TAP2
Locus DAAP-57C1.2 Gene Type protein-coding
Synonyms ABC18; ABCB3; APT2; D6S217E; PSF2; RING11
Full Name transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
Description transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
Chromosome 6p21.3
Also Known As ABC transporter, MHC 2; ATP-binding cassette, sub-family B (MDR/TAP), member 3; OTTHUMP00000029079; OTTHUMP00000038912; OTTHUMP00000038914; antigen peptide transporter 2; peptide supply factor 2; peptide transporter PSF2; transporter 2, ABC (ATP binding cassette); transporter 2, ATP-binding cassette, sub-family B
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This gene is located 7 kb telomeric to gene family member ABCB2. The protein encoded by this gene is involved in antigen presentation. This protein forms a heterodimer with ABCB2 in order to transport peptides from the cytoplasm to the endoplasmic reticulum. Mutations in this gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Alternative splicing of this gene produces two products which differ in peptide selectivity and level of restoration of surface expression of MHC class I molecules. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37323

ID Symbol Protein Species
GeneID:6891 TAP2 NP_000535.3 Homo sapiens
GeneID:21355 Tap2 NP_035660.2 Mus musculus
GeneID:24812 Tap2 NP_114445.1 Rattus norvegicus
GeneID:281586 TAP2 NP_776647.1 Bos taurus
GeneID:368771 abcb3l1 NP_001006594.1 Danio rerio
GeneID:474864 TAP2 XP_532099.2 Canis lupus familiaris
GeneID:556826 LOC556826 XP_682981.1 Danio rerio
GeneID:618733 TAP2 NP_001040087.1 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab60113 TAP2 antibody (ab60113); Rabbit polyclonal to TAP2
2 abgent AP6253a TAP2 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
3 acris AP13227PU-N TAP2 (MDR/TAP) (C-term); antibody Ab
4 scbt TAP2 TAP2 Antibody / TAP2 Antibodies;
5 sigma HPA001312 Anti-TAP2 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of TAP2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of TAP2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005829 Component cytosol
GO:0005783 Component endoplasmic reticulum
GO:0005788 Component endoplasmic reticulum lumen
GO:0005789 Component endoplasmic reticulum membrane
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005634 Component nucleus
GO:0042825 Component TAP complex
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0004409 Function homoaconitate hydratase activity
GO:0042288 Function MHC class I protein binding
GO:0000166 Function nucleotide binding
GO:0015198 Function oligopeptide transporter activity
GO:0042605 Function peptide antigen binding
GO:0015433 Function peptide antigen-transporting ATPase activity
GO:0042301 Function phosphate binding
GO:0046982 Function protein heterodimerization activity
GO:0046980 Function tapasin binding
GO:0005215 Function transporter activity
GO:0019885 Process antigen processing and presentation of endogenous peptide antigen via MHC class I
GO:0046967 Process cytosol to ER transport
GO:0006955 Process immune response
GO:0006886 Process intracellular protein transport
GO:0006857 Process oligopeptide transport
GO:0006461 Process protein complex assembly

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_000544  UCSC Browser NP_000535
2 NM_018833  UCSC Browser NP_061313

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000374897 MI0003677 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU
ENST00000374899 MI0000443 hsa-miR-124* CGUGUUCACAGCGGACCUUGAU
ENST00000374899 MI0000444 hsa-miR-124* CGUGUUCACAGCGGACCUUGAU
ENST00000374899 MI0000445 hsa-miR-124* CGUGUUCACAGCGGACCUUGAU
ENST00000374899 MI0000075 hsa-miR-19b-2* AGUUUUGCAGGUUUGCAUUUCA
ENST00000374899 MI0000295 hsa-miR-218-2* CAUGGUUCUGUCAAGCACCGCG
ENST00000374899 MI0000740 hsa-miR-219-2-3p AGAAUUGUGGCUGGACAUCUGU
ENST00000374899 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENST00000374899 MI0000781 hsa-miR-373* ACUCAAAAUGGGGGCGCUUUCC
ENST00000374899 MI0000783 hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA
ENST00000374899 MI0000788 hsa-miR-380* UGGUUGACCAUAGAACAUGCGC
ENST00000374899 MI0001145 hsa-miR-384 AUUCCUAGAAAUUGUUCAUA
ENST00000374899 MI0001735 hsa-miR-409-3p GAAUGUUGCUCGGUGAACCCCU
ENST00000374899 MI0001723 hsa-miR-433 AUCAUGAUGGGCUCCUCGGUGU
ENST00000374899 MI0003589 hsa-miR-582-5p UUACAGUUGUUCAACCAGUUACU
ENST00000374899 MI0003629 hsa-miR-616* ACUCAAAACCCUUCAGUGACUU
ENST00000374899 MI0003649 hsa-miR-634 AACCAGCACCCCAACUUUGGAC
ENST00000374899 MI0003660 hsa-miR-645 UCUAGGCUGGUACUGCUGA
ENST00000374899 MI0005541 hsa-miR-875-3p CCUGGAAACACUGAGGUUGUG
ENST00000374899 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENST00000374899 MI0005713 hsa-miR-921 CUAGUGAGGGACAGAACCAGGAUUC
ENST00000374899 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENST00000374899 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENST00000374899 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG
ENST00000374899 MI0004634 mmu-miR-677 UUCAGUGAUGAUUAGCUUCUGA
ENST00000374899 MI0004652 mmu-miR-687 CUAUCCUGGAAUGCAGCAAUGA
ENST00000374899 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENST00000374899 MI0005548 mmu-miR-878-5p UAUCUAGUUGGAUGUCAAGACA
ENST00000374899 MI0005472 mmu-miR-879 AGAGGCUUAUAGCUCUAAGCC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

AB073779   AB208953   AF078671   AF105151   AF152583   AF176984   AK222823   AK223300   AK225657   AK225693   AK292963   AK299603   AL833658   BC002751   BC152839   BG423357   BT009906   EU832685   FM246456   L09191   L09271   L10287   M74447   M84748   NM_000544   NM_018833   U07844   Z22935   Z22936  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Carbon Tetrachloride
  • Carbon Tetrachloride affects the expression of TAP2 mRNA
17484886
Paraquat
  • Paraquat results in decreased expression of TAP2 mRNA
16854511
pirinixic acid
  • pirinixic acid results in decreased expression of TAP2 mRNA
17426115

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
BARE LYMPHOCYTE SYNDROME, TYPE I marker
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Agricultural Workers' Diseases inferred via Paraquat 11874814
Gliosis inferred via Paraquat 11124998
Nerve Degeneration inferred via Paraquat 16893418
Parkinson Disease inferred via Paraquat 12911755, 11445065, 16510128, 15451049, 11124998, 16140633, 15824117, 11181820
Pneumonia inferred via Paraquat 12504350
Pulmonary Fibrosis inferred via Paraquat 16324872, 17997886
Respiratory Distress Syndrome, Adult inferred via Paraquat 11700416
Respiratory Sounds inferred via Paraquat 11874814
Retinal Degeneration inferred via Paraquat 16458197
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16050911, 15673190, 16124888, 16227642, 15700767, 10355542, 16011737, 16097048
Fatty Liver inferred via Carbon Tetrachloride 16045604, 16239168, 12795759, 61145, 12631006, 17595544, 15959796
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 11566570, 16177239, 16227642, 15027814, 15968718, 15998439
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 16221502, 16239168, 17334410
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 16116963, 15925388, 17525996, 17557913, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 15052691, 12632512, 17766677, 18418968, 12666154, 16638106, 18395095, 18156304, 17976157, 16097048, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 17805973, 16248980
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15720792, 15830285, 16964402, 17285989
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
HLA-C HLA-C / TAP2 Invivo Neisig A (1998)
HLA-G TAP2 / HLA-G Affinity Capture-Western Gobin SJ (1997)
TAP1 TAP1 / TAP2 Reconstituted Complex Karttunen JT (2001)
TAPBP TAPBP / TAP2 Reconstituted Complex Raghuraman G (2002)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Vignal C, et al. (2009) "Genetic association of the major histocompatibility complex with rheumatoid arthritis implicates two non-DRB1 loci." Arthritis Rheum. 60(1):53-62. PMID:19116923
  2. [ + ] Hoves S, et al. (2009) "In situ analysis of the antigen-processing machinery in acute myeloid leukaemic blasts by tissue microarray." Leukemia. 23(5):877-885. PMID:19148137
  3. [ + ] Einstein MH, et al. (2009) "Genetic variants in TAP are associated with high-grade cervical neoplasia." Clin Cancer Res. 15(3):1019-1023. PMID:19188174
  4. [ + ] Mehta AM, et al. (2009) "Single nucleotide polymorphisms in antigen processing machinery component ERAP1 significantly associate with clinical outcome in cervical carcinoma." Genes Chromosomes Cancer. 48(5):410-418. PMID:19202550
  5. [ + ] Fellerhoff B, et al. (2009) "Transporter associated with antigen processing and the chaperone tapasin: are non-classical HLA genes keys to the pathogenesis of schizophrenia?" Med Hypotheses. 72(5):535-538. PMID:19217216
  6. [ + ] Siezen CL, et al. (2009) "Genetic susceptibility to respiratory syncytial virus bronchiolitis in preterm children is associated with airway remodeling genes and innate immune genes." Pediatr Infect Dis J. 28(4):333-335. PMID:19258923
  7. [ + ] Kordi Tamandani DM, et al. (2009) "No association of TAP1 and TAP2 genes polymorphism with risk of cervical cancer in north Indian population." J Assist Reprod Genet. 26(4):173-178. PMID:19263211
  8. [ + ] Oancea G, et al. (2009) "Structural arrangement of the transmission interface in the antigen ABC transport complex TAP." Proc Natl Acad Sci U S A. 106(14):5551-5556. PMID:19297616
  9. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  10. [ + ] Ramos PS, et al. (2009) "Variation in the ATP-binding cassette transporter 2 gene is a separate risk factor for systemic lupus erythematosus within the MHC." Genes Immun. 10(4):350-355. PMID:19387463
  11. [ + ] Maksymowych WP, et al. (2009) "Association of a specific ERAP1/ARTS1 haplotype with disease susceptibility in ankylosing spondylitis." Arthritis Rheum. 60(5):1317-1323. PMID:19404951
  12. [ + ] Feng M, et al. (2009) "TAP1 and TAP2 polymorphisms associated with ankylosing spondylitis in genetically homogenous Chinese Han population." Hum Immunol. 70(4):257-261. PMID:19480848
  13. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  14. [ + ] Soundravally R, et al. (2008) "Significance of transporter associated with antigen processing 2 (TAP2) gene polymorphisms in susceptibility to dengue viral infection." J Clin Immunol. 28(3):256-262. PMID:18071882
  15. [ + ] Deshpande A, et al. (2008) "Variation in HLA class I antigen-processing genes and susceptibility to human papillomavirus type 16-associated cervical cancer." J Infect Dis. 197(3):371-381. PMID:18248301
  16. [ + ] Lee HS, et al. (2008) "Several regions in the major histocompatibility complex confer risk for anti-CCP-antibody positive rheumatoid arthritis, independent of the DRB1 locus." Mol Med. 14(5-6):293-300. PMID:18309376
  17. [ + ] Tao J, et al. (2008) "Restoration of the expression of transports associated with antigen processing in human malignant melanoma increases tumor-specific immunity." J Invest Dermatol. 128(8):1991-1996. PMID:18385764
  18. [ + ] Soundravally R, et al. (2008) "Polymorphisms of the TAP 1 and 2 gene may influence clinical outcome of primary dengue viral infection." Scand J Immunol. 67(6):618-625. PMID:18433405
  19. [ + ] Moschonas A, et al. (2008) "CD40 induces antigen transporter and immunoproteasome gene expression in carcinomas via the coordinated action of NF-kappaB and of NF-kappaB-mediated de novo synthesis of IRF-1." Mol Cell Biol. 28(20):6208-6222. PMID:18694960
  20. [ + ] Feng ML, et al. (2008) "Determination of TAP1 and TAP2 polymorphism in the Chinese Han population by real-time TaqMan polymerase chain reaction." Tissue Antigens. 72(5):441-447. PMID:18764808
  21. [ + ] Kim JJ, et al. (2008) "Genetic variants in the HLA-G region are associated with Kawasaki disease." Hum Immunol. 69(12):867-871. PMID:18976687
  22. [ + ] Bullido MJ, et al. (2007) "A TAP2 genotype associated with Alzheimer's disease in APOE4 carriers." Neurobiol Aging. 28(4):519-523. PMID:16595160
  23. [ + ] Qu HQ, et al. (2007) "Genetic control of alternative splicing in the TAP2 gene: possible implication in the genetics of type 1 diabetes." Diabetes. 56(1):270-275. PMID:17192492
  24. [ + ] Dogru D, et al. (2007) "The role of TAP1 and TAP2 gene polymorphism in idiopathic bronchiectasis in children." Pediatr Pulmonol. 42(3):237-241. PMID:17245734
  25. [ + ] Xu C, et al. (2007) "Genetic polymorphisms of LMP/TAP gene and hepatitis B virus infection risk in the Chinese population." J Clin Immunol. 27(5):534-541. PMID:17525827
  26. [ + ] Kramer U, et al. (2007) "Strong associations of psoriasis with antigen processing LMP and transport genes TAP differ by gender and phenotype." Genes Immun. 8(6):513-517. PMID:17581627
  27. [ + ] Janssen R, et al. (2007) "Genetic susceptibility to respiratory syncytial virus bronchiolitis is predominantly associated with innate immune genes." J Infect Dis. 196(6):826-834. PMID:17703412
  28. [ + ] Rufer E, et al. (2007) "Molecular architecture of the TAP-associated MHC class I peptide-loading complex." J Immunol. 179(9):5717-5727. PMID:17947644
  29. [ + ] Kim KR, et al. (2007) "TAP1 and TAP2 gene polymorphisms in Korean patients with allergic rhinitis." J Korean Med Sci. 22(5):825-831. PMID:17982230
  30. [ + ] Halenius A, et al. (2006) "Physical and functional interactions of the cytomegalovirus US6 glycoprotein with the transporter associated with antigen processing." J Biol Chem. 281(9):5383-5390. PMID:16356928
  31. [ + ] Hahn Y, et al. (2006) "Human-specific nonsense mutations identified by genome sequence comparisons." Hum Genet. 119(1-2):169-178. PMID:16395595
  32. [ + ] Gomez LM, et al. (2006) "Analysis of IL1B, TAP1, TAP2 and IKBL polymorphisms on susceptibility to tuberculosis." Tissue Antigens. 67(4):290-296. PMID:16634865
  33. [ + ] Chen RH, et al. (2006) "Association between the TAP2 gene codon 665 polymorphism and Graves' disease." J Clin Lab Anal. 20(3):93-97. PMID:16721835
  34. [ + ] Hwang Y, et al. (2006) "Genetic predisposition of responsiveness to therapy for chronic hepatitis C." Pharmacogenomics. 7(5):697-709. PMID:16886895
  35. [ + ] Yilmaz I, et al. (2006) "No difference in polymorphism frequency in a Turkish population with allergic rhinitis." Acta Otolaryngol. 126(10):1110-1111. PMID:16923719
  36. [ + ] Perria CL, et al. (2006) "Catalytic site modifications of TAP1 and TAP2 and their functional consequences." J Biol Chem. 281(52):39839-39851. PMID:17068338
  37. [ + ] Begley GS, et al. (2005) "Cytoplasmic domains of the transporter associated with antigen processing and P-glycoprotein interact with subunits of the proteasome." Mol Immunol. 42(1):137-141. PMID:15488952
  38. [ + ] Koch J, et al. (2005) "Exploring the minimal functional unit of the transporter associated with antigen processing." FEBS Lett. 579(20):4413-4416. PMID:16061226
  39. [ + ] Song YW, et al. (2005) "Association of TAP1 and TAP2 gene polymorphisms with systemic sclerosis in Korean patients." Hum Immunol. 66(7):810-817. PMID:16112028
  40. [ + ] Procko E, et al. (2005) "Identification of domain boundaries within the N-termini of TAP1 and TAP2 and their importance in tapasin binding and tapasin-mediated increase in peptide loading of MHC class I." Immunol Cell Biol. 83(5):475-482. PMID:16174096
  41. [ + ] Zhang Z, et al. (2005) "Analysis of TAP1 and TAP2 polymorphism of mother-infant in Chinese patients with pre-eclampsia." Cell Mol Immunol. 2(2):141-144. PMID:16191421
  42. [ + ] Leonhardt RM, et al. (2005) "Critical role for the tapasin-docking site of TAP2 in the functional integrity of the MHC class I-peptide-loading complex." J Immunol. 175(8):5104-5114. PMID:16210614
  43. [ + ] Huang SH, et al. (2005) "TAP 2 gene Msp-I polymorphism might be associated with calcium oxalate stone disease." Urol Int. 75(3):264-268. PMID:16215317
  44. [ + ] Alvarado-Guerri R, et al. (2005) "TAP1 and TAP2 polymorphisms and their linkage disequilibrium with HLA-DR, -DP, and -DQ in an eastern Andalusian population." Hum Immunol. 66(8):921-930. PMID:16216677
  45. [ + ] Slomov E, et al. (2005) "Pemphigus vulgaris is associated with the transporter associated with antigen processing (TAP) system." Hum Immunol. 66(12):1213-1222. PMID:16690408
  46. [ + ] Sia C, et al. (2005) "Genetic susceptibility to type 1 diabetes in the intracellular pathway of antigen processing - a subject review and cross-study comparison." Rev Diabet Stud. 2(1):40-52. PMID:17491658
  47. [ + ] Koch J, et al. (2004) "Functional dissection of the transmembrane domains of the transporter associated with antigen processing (TAP)." J Biol Chem. 279(11):10142-10147. PMID:14679198
  48. [ + ] Yu MC, et al. (2004) "Association of TAP2 gene polymorphisms in Chinese patients with rheumatoid arthritis." Clin Rheumatol. 23(1):35-39. PMID:14749980
  49. [ + ] Jun TY, et al. (2004) "No association of TAP2 polymorphisms in Korean patients with schizophrenia." Psychiatr Genet. 14(3):173-176. PMID:15318034
  50. [ + ] Cesari M, et al. (2004) "Is TAP2*0102 allele involved in insulin-dependent diabetes mellitus (type 1) protection?" Hum Immunol. 65(8):783-793. PMID:15336779