A4gnt | GeneID:685758 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 685758 Official Symbol A4gnt
Locus N/A Gene Type protein-coding
Synonyms
Full Name alpha-1,4-N-acetylglucosaminyltransferase
Description alpha-1,4-N-acetylglucosaminyltransferase
Chromosome 8q31
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 87446

ID Symbol Protein Species
GeneID:51146 A4GNT NP_057245.1 Homo sapiens
GeneID:333424 A4gnt NP_001070892.1 Mus musculus
GeneID:429136 A4GNT XP_426692.2 Gallus gallus
GeneID:460724 A4GNT XP_516775.2 Pan troglodytes
GeneID:485683 A4GNT XP_542803.2 Canis lupus familiaris
GeneID:540795 A4GNT XP_613170.1 Bos taurus
GeneID:685758 A4gnt XP_001065156.1 Rattus norvegicus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005795 Component Golgi stack
GO:0005730 Component nucleolus
GO:0005634 Component nucleus
GO:0008375 Function acetylglucosaminyltransferase activity
GO:0008378 Function galactosyltransferase activity
GO:0009101 Process glycoprotein biosynthetic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001065156  UCSC Browser XP_001065156
2 XM_001070727  UCSC Browser XP_001070727

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000039690 MI0003578 hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG
ENSRNOT00000039690 MI0005713 hsa-miR-921 CUAGUGAGGGACAGAACCAGGAUUC
ENSRNOT00000039690 MI0004634 mmu-miR-677 UUCAGUGAUGAUUAGCUUCUGA
ENSRNOT00000039690 MI0004649 mmu-miR-685 UCAAUGGCUGAGGUGAGGCAC
ENSRNOT00000039690 MI0004306 mmu-miR-761 GCAGCAGGGUGAAACUGACACA
ENSRNOT00000039690 MI0000886 rno-miR-101a UACAGUACUGUGAUAACUGAA
ENSRNOT00000039690 MI0000918 rno-miR-145 GUCCAGUUUUCCCAGGAAUCCCU
ENSRNOT00000039690 MI0000946 rno-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENSRNOT00000039690 MI0000850 rno-miR-21* CAACAGCAGUCGAUGGGCUGUC
ENSRNOT00000039690 MI0000951 rno-miR-211 UUCCCUUUGUCAUCCUUUGCCU
ENSRNOT00000039690 MI0000954 rno-miR-214 ACAGCAGGCACAGACAGGCAG
ENSRNOT00000039690 MI0006152 rno-miR-495 AAACAAACAUGGUGCACUUCUU
ENSRNOT00000039690 MI0006154 rno-miR-532-5p CAUGCCUUGAGUGUAGGACUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene