0610037M15Rik | GeneID:68395 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 68395 Official Symbol 0610037M15Rik
Locus N/A Gene Type protein-coding
Synonyms
Full Name RIKEN cDNA 0610037M15 gene
Description RIKEN cDNA 0610037M15 gene
Chromosome N/A
Also Known As
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_903697  UCSC Browser XP_908790

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000091611 MI0003161 hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU
ENSMUST00000091611 MI0003174 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU
ENSMUST00000091611 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENSMUST00000091611 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENSMUST00000091611 MI0005533 hsa-miR-890 UACUUGGAAAGGCAUCAGUUG
ENSMUST00000091611 MI0000228 mmu-miR-186 CAAAGAAUUCUCCUUUUGGGCU
ENSMUST00000091611 MI0000623 mmu-miR-340-3p UCCGUCUCAGUUACUUUAUAGC
ENSMUST00000091611 MI0004965 mmu-miR-652 AAUGGCGCCACUAGGGUUGUG
ENSMUST00000091611 MI0004681 mmu-miR-697 AACAUCCUGGUCCUGUGGAGA
ENSMUST00000091611 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU
ENSMUST00000091611 MI0005477 mmu-miR-883b-3p UAACUGCAACAUCUCUCAGUAU
ENSMUST00000091611 MI0000147 mmu-miR-99b* CAAGCUCGUGUCUGUGGGUCCG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  2. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  3. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  5. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  6. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  7. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  8. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
  9. [ + ] Cai W, et al. (1996) "Sequence and transcription of Qa-2-encoding genes in mouse lymphocytes and blastocysts." Immunogenetics. 45(2):97-107. PMID:8952959
  10. [ + ] Weiss EH, et al. (1984) "Organization and evolution of the class I gene family in the major histocompatibility complex of the C57BL/10 mouse." Nature. 310(5979):650-655. PMID:6088985