0610030E20Rik | GeneID:68364 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 68364 Official Symbol 0610030E20Rik
Locus N/A Gene Type protein-coding
Synonyms 2810411C16Rik; AI461894
Full Name RIKEN cDNA 0610030E20 gene
Description RIKEN cDNA 0610030E20 gene
Chromosome 6 C3|6
Also Known As hypothetical protein LOC68364
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 19243

ID Symbol Protein Species
GeneID:68364 0610030E20Rik XP_132614.2 Mus musculus
GeneID:388969 C2orf68 NP_001013671.2 Homo sapiens
GeneID:612043 LOC612043 XP_854864.1 Canis lupus familiaris
GeneID:616899 LOC616899 XP_874129.2 Bos taurus
GeneID:691113 LOC691113 XP_001076881.1 Rattus norvegicus
GeneID:100001127 CH211-283H6.4 NP_001108165.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_026696  UCSC Browser NP_080972
2 XM_132614  UCSC Browser XP_132614
3 XM_910556  UCSC Browser XP_915649

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000077783 MI0000572 mmu-miR-24-2* GUGCCUACUGAGCUGAAACAGU
ENSMUST00000077783 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENSMUST00000077783 MI0004696 mmu-miR-712 CUCCUUCACCCGGGCGGUACC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  2. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  3. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  5. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  6. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  7. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  8. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
  9. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548