0610011F06Rik | GeneID:68347 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 68347 Official Symbol 0610011F06Rik
Locus N/A Gene Type protein-coding
Synonyms
Full Name RIKEN cDNA 0610011F06 gene
Description RIKEN cDNA 0610011F06 gene
Chromosome 17 A3.3
Also Known As hypothetical protein LOC68347
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 16917

ID Symbol Protein Species
GeneID:50438 CG18661 NP_652562.2 Drosophila melanogaster
GeneID:68347 0610011F06Rik NP_080962.1 Mus musculus
GeneID:84326 C16orf13 NP_115742.3 Homo sapiens
GeneID:302998 RGD1307155 NP_001032265.1 Rattus norvegicus
GeneID:386899 zgc:56719 NP_956410.1 Danio rerio
GeneID:467858 LOC467858 XP_001154838.1 Pan troglodytes
GeneID:490093 LOC490093 XP_547214.2 Canis lupus familiaris
GeneID:514636 C25H16ORF13 NP_001033195.1 Bos taurus
GeneID:1279388 AgaP_AGAP009967 XP_319104.2 Anopheles gambiae
GeneID:3564786 Y26E6A.3 NP_001024956.1 Caenorhabditis elegans

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_026686  UCSC Browser NP_080962

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000026827 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENSMUST00000026827 MI0003679 hsa-miR-549 UGACAACUAUGGAUGAGCUCU
ENSMUST00000026827 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENSMUST00000026827 MI0003614 hsa-miR-601 UGGUCUAGGAUUGUUGGAGGAG
ENSMUST00000026827 MI0003624 hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC
ENSMUST00000026827 MI0003643 hsa-miR-629 UGGGUUUACGUUGGGAGAACU
ENSMUST00000026827 MI0003681 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG
ENSMUST00000026827 MI0000221 mmu-miR-10b UACCCUGUAGAACCGAAUUUGUG
ENSMUST00000026827 MI0000153 mmu-miR-126-3p UCGUACCGUGAGUAAUAAUGCG
ENSMUST00000026827 MI0000693 mmu-miR-139-5p UCUACAGUGCACGUGUCUCCAG
ENSMUST00000026827 MI0001151 mmu-miR-196b UAGGUAGUUUCCUGUUGUUGGG
ENSMUST00000026827 MI0000578 mmu-miR-27a UUCACAGUGGCUAAGUUCCGC
ENSMUST00000026827 MI0000142 mmu-miR-27b UUCACAGUGGCUAAGUUCUGC
ENSMUST00000026827 MI0000690 mmu-miR-28* CACUAGAUUGUGAGCUGCUGGA
ENSMUST00000026827 MI0000394 mmu-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENSMUST00000026827 MI0000394 mmu-miR-296-5p AGGGCCCCCCCUCAAUCCUGU
ENSMUST00000026827 MI0000592 mmu-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENSMUST00000026827 MI0004637 mmu-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU
ENSMUST00000026827 MI0005497 mmu-miR-453 AGGUUGCCUCAUAGUGAGCUUGCA
ENSMUST00000026827 MI0003522 mmu-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENSMUST00000026827 MI0004171 mmu-miR-665 ACCAGGAGGCUGAGGUCCCU
ENSMUST00000026827 MI0005003 mmu-miR-676* ACUCUACAACCUUAGGACUUGC
ENSMUST00000026827 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENSMUST00000026827 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Hoffman BG, et al. (2008) "Identification of transcripts with enriched expression in the developing and adult pancreas." Genome Biol. 9(6):R99. PMID:18554416
  2. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  3. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  4. [ + ] Watahiki A, et al. (2004) "Libraries enriched for alternatively spliced exons reveal splicing patterns in melanocytes and melanomas." Nat Methods. 1(3):233-239. PMID:15782199
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  7. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  8. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  9. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  10. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636