ABCC8 | GeneID:6833 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 6833 Official Symbol ABCC8
Locus N/A Gene Type protein-coding
Synonyms ABC36; HHF1; HI; HRINS; MRP8; PHHI; SUR; SUR1; TNDM2
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 8
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 8
Chromosome 11p15.1
Also Known As ATP-binding cassette, sub-family C, member 8; sulfonylurea receptor (hyperinsulinemia)
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a modulator of ATP-sensitive potassium channels and insulin release. Mutations and deficiencies in this protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. Mutations have also been associated with non-insulin-dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion. Alternative splicing of this gene has been observed; however, the transcript variants have not been fully described. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68048

ID Symbol Protein Species
GeneID:6833 ABCC8 NP_000343.2 Homo sapiens
GeneID:20927 Abcc8 NP_035640.2 Mus musculus
GeneID:25559 Abcc8 NP_037171.1 Rattus norvegicus
GeneID:423072 ABCC8 XP_421005.2 Gallus gallus
GeneID:451056 ABCC8 XP_508310.2 Pan troglodytes
GeneID:485402 ABCC8 XP_542520.2 Canis lupus familiaris
GeneID:538996 ABCC8 XP_584132.3 Bos taurus
GeneID:553281 abcc8 XP_001920483.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab57459 SUR1 antibody (ab57459); Mouse monoclonal to SUR1
2 abcam ab32844 SUR1 antibody (ab32844); Rabbit polyclonal to SUR1
3 abnova H00006833-M01 ABCC8 monoclonal antibody (M01), clone 3G5; Mouse monoclonal antibody raised against a partial recombinant ABCC8.
4 abnova H00006833-M01A ABCC8 monoclonal antibody (M01), clone 3G5; Mouse monoclonal antibody raised against a partial recombinant ABCC8.
5 acris AP17054PU-N ABCC8 (C-term); antibody Ab
6 scbt ABCC8 ABCC8 Antibody / ABCC8 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCC8 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCC8 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0005886 Component plasma membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0015079 Function potassium ion transmembrane transporter activity
GO:0004872 Function receptor activity
GO:0008281 Function sulfonylurea receptor activity
GO:0005975 Process carbohydrate metabolic process
GO:0006813 Process potassium ion transport
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_000352  UCSC Browser NP_000343

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000389817 MI0000060 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000389817 MI0000061 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000389817 MI0000062 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000389817 MI0000063 hsa-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENST00000389817 MI0000065 hsa-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENST00000389817 MI0000067 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000389817 MI0000068 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000389817 MI0000261 hsa-miR-139-3p GGAGACGCGGCCCUGUUGGAGU
ENST00000389817 MI0000272 hsa-miR-182* UGGUUCUAGACUUGCCAACUA
ENST00000389817 MI0000234 hsa-miR-192* CUGCCAAUUCCAUAGGUCACAG
ENST00000389817 MI0000439 hsa-miR-23b* UGGGUUCCUGGCAUGCUGAUUU
ENST00000389817 MI0000744 hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU
ENST00000389817 MI0000824 hsa-miR-325 CCUAGUAGGUGUCCAGUAAGUGU
ENST00000389817 MI0003562 hsa-miR-556-5p GAUGAGCUCAUUGUAAUAUGAG
ENST00000389817 MI0003660 hsa-miR-645 UCUAGGCUGGUACUGCUGA
ENST00000389817 MI0005541 hsa-miR-875-5p UAUACCUCAGUUUUAUCAGGUG
ENST00000389817 MI0002403 mmu-miR-468 UAUGACUGAUGUGCGUGUGUCUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

AB209084   AF087138   AK297560   AW444836   BC167829   DB636549   L40625   L78207   NM_000352   R84665   U63421  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen results in decreased expression of ABCC8 mRNA
15976192
bromobenzene
  • bromobenzene results in decreased expression of ABCC8 mRNA
15976192
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ABCC8 protein
17544377
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ABCC8 mRNA
15976192
Dimethylnitrosamine
  • Dimethylnitrosamine results in decreased expression of ABCC8 mRNA
15976192
Flavonoids
  • Flavonoids results in increased expression of ABCC8 mRNA
18035473
Glyburide
  • Glyburide binds to and results in decreased activity of ABCC8 protein
15652236
Glyburide
  • resveratrol inhibits the reaction [Glyburide binds to ABCC8 protein]
17138562
Mifepristone
  • Mifepristone results in decreased expression of ABCC8 mRNA
17584828
resveratrol
  • resveratrol binds to ABCC8 protein
  • resveratrol inhibits the reaction [Glyburide binds to ABCC8 protein]
17138562
Thioacetamide
  • Thioacetamide results in decreased expression of ABCC8 mRNA
15976192
Tolbutamide
  • Tolbutamide binds to and results in decreased activity of ABCC8 protein
15652236
Uranium
  • Uranium affects the expression of ABCC8 mRNA
15672453
uranyl acetate
  • uranyl acetate affects the expression of ABCC8 mRNA
15672453

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
DIABETES MELLITUS, PERMANENT NEONATAL marker
DIABETES MELLITUS, TRANSIENT NEONATAL, 2 marker
Diabetes Mellitus, Type 2 marker
HYPERINSULINEMIC HYPOGLYCEMIA, FAMILIAL, 1 marker
HYPOGLYCEMIA, LEUCINE-INDUCED marker
Liver Cirrhosis, Experimental inferred via Thioacetamide 16248980, 18395095, 18295389, 16097051
Adenoma inferred via resveratrol 15688382
Alzheimer Disease inferred via resveratrol 16183991, 16162502
Arthritis, Experimental inferred via resveratrol 17115116
Atherosclerosis inferred via resveratrol 16873680, 17967414
Brain Ischemia inferred via resveratrol 17600658
Breast Neoplasms inferred via resveratrol 17651959, 17534123, 16393696
Carcinoma, Hepatocellular inferred via resveratrol 16227395
Carcinoma, Lewis Lung inferred via resveratrol 16675471
Carcinoma, Squamous Cell inferred via resveratrol 16227395
Cardiovascular Diseases inferred via resveratrol 15458977
Colitis inferred via resveratrol 16474422
Colonic Neoplasms inferred via resveratrol 16338953
Colorectal Neoplasms inferred via resveratrol 16550006
Diabetes Mellitus, Experimental inferred via resveratrol 16873680
Diabetic Nephropathies inferred via resveratrol 16286809
Edema inferred via resveratrol 8985016
Encephalomyelitis, Autoimmune, Experimental inferred via resveratrol 17872969
Enterocolitis, Necrotizing inferred via resveratrol 17923197
Herpes Simplex inferred via resveratrol 16876885
Hypercholesterolemia inferred via resveratrol 17188708
Hyperlipidemias inferred via resveratrol 16873680
Hypertrophy, Left Ventricular inferred via resveratrol 17488730
Infarction, Middle Cerebral Artery inferred via resveratrol 17600658
Inflammation inferred via resveratrol 16366677
Influenza, Human inferred via resveratrol 16624496
Kidney Failure, Acute inferred via resveratrol 16538975
Leukemia, Promyelocytic, Acute inferred via resveratrol 16087638
Lymphoma, B-Cell inferred via resveratrol 17088997
Lymphoma, Non-Hodgkin inferred via resveratrol 14749477
Mammary Neoplasms, Animal inferred via resveratrol 15688416
Mammary Neoplasms, Experimental inferred via resveratrol 8985016, 11606380
Melanoma inferred via resveratrol 17992120
Metabolic Diseases inferred via resveratrol 17112576
Multiple Myeloma inferred via resveratrol 14749477, 17935668, 17049120, 16267019, 16490592, 17164350
Muscular Atrophy, Spinal inferred via resveratrol 17962980
Myocardial Infarction inferred via resveratrol 17188708, 17125593, 17015251, 16456233, 16317513, 16525036
Myocardial Ischemia inferred via resveratrol 17125593, 17015251
Myocarditis inferred via resveratrol 17322642
Neoplasms, Experimental inferred via resveratrol 8985016
Neurodegenerative Diseases inferred via resveratrol 17652729
Neurogenic Inflammation inferred via resveratrol 17929310
Osteoporosis, Postmenopausal inferred via resveratrol 17513867
Prenatal Exposure Delayed Effects inferred via resveratrol 16679765
Prostatic Neoplasms inferred via resveratrol 17675339, 17636462, 17804756, 16731767, 15767336, 17718901
Renal Insufficiency, Chronic inferred via resveratrol 16325855
Reperfusion Injury inferred via resveratrol 17058453, 17520802, 15827377, 16317513, 16314181
Skin Neoplasms inferred via resveratrol 15837718, 8985016
STROKE, ISCHEMIC inferred via resveratrol 16321402
Tongue Neoplasms inferred via resveratrol 16227395
Uterine Cervical Neoplasms inferred via resveratrol 17473185
Uterine Neoplasms inferred via resveratrol 17044934
Ventricular Dysfunction, Left inferred via resveratrol 17488730
Endometriosis inferred via Mifepristone 16134523
Ovarian Neoplasms inferred via Mifepristone 16525653
Neurotoxicity Syndromes inferred via Glyburide 16725203
Inflammation inferred via Flavonoids 17296493
Adenocarcinoma inferred via Dimethylnitrosamine 16033868
Carcinoma, Squamous Cell inferred via Dimethylnitrosamine 16033868
Esophageal Neoplasms inferred via Dimethylnitrosamine 17016578
Liver Cirrhosis, Experimental inferred via Dimethylnitrosamine 17203207, 14659978, 17348192, 17201889, 18237412, 17719030, 15081153, 16169303, 14643895, 18567088, 15798949, 18629640, 15864749, 15763062, 16544323, 15842777, 15793283, 18371158, 12925901, 15366600, 15571005, 15161499, 12918455, 15298665, 16042886, 15479170, 17196135, 15383259, 14726149, 16627068, 15942678, 15744066, 15591649, 18239293, 16270385, 17881167, 15492853, 15733078, 16009107, 18637143, 18672772, 15067225, 17640959, 18364076, 15369754, 15099470, 15339415, 17432682, 17198567, 15086199, 14709902, 15577212, 15504291, 17666798, 15138612, 16603200, 17724770, 15723089, 14568256, 18210741, 17465448, 18095165, 16570917, 17036385, 17534399
Liver Failure, Acute inferred via Dimethylnitrosamine 17457977
Liver Neoplasms inferred via Dimethylnitrosamine 3113478, 15890375
Liver Neoplasms, Experimental inferred via Dimethylnitrosamine 15603536
Lung Neoplasms inferred via Dimethylnitrosamine 16061637
Stomach Neoplasms inferred via Dimethylnitrosamine 16033868
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 15673190, 16011737, 15700767, 16124888, 16227642, 10355542, 16097048, 16050911
Fatty Liver inferred via Carbon Tetrachloride 16045604, 15959796, 17595544, 12631006, 61145, 12795759, 16239168
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 15027814, 15968718, 16227642, 15998439, 16177239, 11566570
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 17334410, 16221502, 16239168
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 16116963, 15925388, 16248980, 17805973, 17976157, 18395095, 12666154, 17766677, 12649538, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 18376398, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 18418968, 16638106, 18156304, 17557913, 17525996
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15720792, 16964402, 15830285, 17285989
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Hepatitis, Toxic inferred via bromobenzene 12628495
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16177239, 15968718, 16227642, 14986274, 16081117, 17522070, 17562736
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
KCNJ11 ABCC8 / KCNJ11 Affinity Capture-Western Babenko AP (2003)
KCNJ11 KCNJ11 / ABCC8 Invivo Inagaki N (1995)
RAPGEF4 ABCC8 / RAPGEF4 Affinity Capture-Western Shibasaki T (2004)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Sandal T, et al. (2009) "The spectrum of ABCC8 mutations in Norwegian patients with congenital hyperinsulinism of infancy." Clin Genet. 75(5):440-448. PMID:19475716
  2. [ + ] Flanagan SE, et al. (2009) "Update of mutations in the genes encoding the pancreatic beta-cell K(ATP) channel subunits Kir6.2 (KCNJ11) and sulfonylurea receptor 1 (ABCC8) in diabetes mellitus and hyperinsulinism." Hum Mutat. 30(2):170-180. PMID:18767144
  3. [ + ] Yoshida T, et al. (2009) "Association of a polymorphism of the apolipoprotein E gene with chronic kidney disease in Japanese individuals with metabolic syndrome." Genomics. 93(3):221-226. PMID:19056482
  4. [ + ] Ruano G, et al. (2009) "Physiogenomic comparison of edema and BMI in patients receiving rosiglitazone or pioglitazone." Clin Chim Acta. 400(1-2):48-55. PMID:18996102
  5. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  6. [ + ] Winkler M, et al. (2009) "Analysis of two KCNJ11 neonatal diabetes mutations, V59G and V59A, and the analogous KCNJ8 I60G substitution: differences between the channel subtypes formed with SUR1." J Biol Chem. 284(11):6752-6762. PMID:19139106
  7. [ + ] Feng Y, et al. (2008) "Ser1369Ala variant in sulfonylurea receptor gene ABCC8 is associated with antidiabetic efficacy of gliclazide in Chinese type 2 diabetic patients." Diabetes Care. 31(10):1939-1944. PMID:18599530
  8. [ + ] Chistiakov DA, et al. (2008) "Genetic variations in the pancreatic ATP-sensitive potassium channel, beta-cell dysfunction, and susceptibility to type 2 diabetes." Acta Diabetol. ():. PMID:18758683
  9. [ + ] Palmer ND, et al. (2008) "Association of the Kir6.2 E23K variant with reduced acute insulin response in African-Americans." J Clin Endocrinol Metab. 93(12):4979-4983. PMID:18796522
  10. [ + ] Rafiq M, et al. (2008) "Effective treatment with oral sulfonylureas in patients with diabetes due to sulfonylurea receptor 1 (SUR1) mutations." Diabetes Care. 31(2):204-209. PMID:18025408
  11. [ + ] Edghill EL, et al. (2008) "Insulin mutation screening in 1,044 patients with diabetes: mutations in the INS gene are a common cause of neonatal diabetes but a rare cause of diabetes diagnosed in childhood or adulthood." Diabetes. 57(4):1034-1042. PMID:18162506
  12. [ + ] Simard JM, et al. (2008) "Sulfonylurea receptor 1 in the germinal matrix of premature infants." Pediatr Res. 64(6):648-652. PMID:18679166
  13. [ + ] Shah JH, et al. (2008) "Alanine in HI: a silent mutation cries out!" Adv Exp Med Biol. 614():145-150. PMID:18290324
  14. [ + ] Hussain K, et al. (2008) "An ABCC8 gene mutation and mosaic uniparental isodisomy resulting in atypical diffuse congenital hyperinsulinism." Diabetes. 57(1):259-263. PMID:17942822
  15. [ + ] Pinney SE, et al. (2008) "Clinical characteristics and biochemical mechanisms of congenital hyperinsulinism associated with dominant KATP channel mutations." J Clin Invest. 118(8):2877-2886. PMID:18596924
  16. [ + ] Solbach TF, et al. (2008) "ATP-binding cassette transporters in human heart failure." Naunyn Schmiedebergs Arch Pharmacol. 377(3):231-243. PMID:18392808
  17. [ + ] Brunetti-Pierri N, et al. (2008) "Case report: pathological features of aberrant pancreatic development in congenital hyperinsulinism due to ABCC8 mutations." Ann Clin Lab Sci. 38(4):386-389. PMID:18988933
  18. [ + ] de Wet H, et al. (2008) "A mutation (R826W) in nucleotide-binding domain 1 of ABCC8 reduces ATPase activity and causes transient neonatal diabetes." EMBO Rep. 9(7):648-654. PMID:18497752
  19. [ + ] Souren NY, et al. (2008) "Anthropometry, carbohydrate and lipid metabolism in the East Flanders Prospective Twin Survey: linkage of candidate genes using two sib-pair based variance components analyses." Twin Res Hum Genet. 11(5):505-516. PMID:18828733
  20. [ + ] Babenko AP, et al. (2008) "A novel ABCC8 (SUR1)-dependent mechanism of metabolism-excitation uncoupling." J Biol Chem. 283(14):8778-8782. PMID:18281290
  21. [ + ] Tarasov AI, et al. (2008) "A rare mutation in ABCC8/SUR1 leading to altered ATP-sensitive K+ channel activity and beta-cell glucose sensing is associated with type 2 diabetes in adults." Diabetes. 57(6):1595-1604. PMID:18346985
  22. [ + ] He YY, et al. (2008) "Association of KCNJ11 and ABCC8 genetic polymorphisms with response to repaglinide in Chinese diabetic patients." Acta Pharmacol Sin. 29(8):983-989. PMID:18664331
  23. [ + ] Abdulhadi-Atwan M, et al. (2008) "Novel de novo mutation in sulfonylurea receptor 1 presenting as hyperinsulinism in infancy followed by overt diabetes in early adolescence." Diabetes. 57(7):1935-1940. PMID:18390792
  24. [ + ] Gussinyer M, et al. (2008) "Glucose intolerance and diabetes are observed in the long-term follow-up of nonpancreatectomized patients with persistent hyperinsulinemic hypoglycemia of infancy due to mutations in the ABCC8 gene." Diabetes Care. 31(6):1257-1259. PMID:18339976
  25. [ + ] Shield JP, et al. (2008) "Mosaic paternal uniparental isodisomy and an ABCC8 gene mutation in a patient with permanent neonatal diabetes and hemihypertrophy." Diabetes. 57(1):255-258. PMID:17942821
  26. [ + ] Yan FF, et al. (2007) "Congenital hyperinsulinism associated ABCC8 mutations that cause defective trafficking of ATP-sensitive K+ channels: identification and rescue." Diabetes. 56(9):2339-2348. PMID:17575084
  27. [ + ] Kilpelainen TO, et al. (2007) "Physical activity modifies the effect of SNPs in the SLC2A2 (GLUT2) and ABCC8 (SUR1) genes on the risk of developing type 2 diabetes." Physiol Genomics. 31(2):264-272. PMID:17636114
  28. [ + ] Bryan J, et al. (2007) "ABCC8 and ABCC9: ABC transporters that regulate K+ channels." Pflugers Arch. 453(5):703-718. PMID:16897043
  29. [ + ] Nielsen LB, et al. (2007) "Co-localisation of the Kir6.2/SUR1 channel complex with glucagon-like peptide-1 and glucose-dependent insulinotrophic polypeptide expression in human ileal cells and implications for glycaemic control in new onset type 1 diabetes." Eur J Endocrinol. 156(6):663-671. PMID:17535866
  30. [ + ] Ellard S, et al. (2007) "Permanent neonatal diabetes caused by dominant, recessive, or compound heterozygous SUR1 mutations with opposite functional effects." Am J Hum Genet. 81(2):375-382. PMID:17668386
  31. [ + ] Vaxillaire M, et al. (2007) "New ABCC8 mutations in relapsing neonatal diabetes and clinical features." Diabetes. 56(6):1737-1741. PMID:17389331
  32. [ + ] Flanagan SE, et al. (2007) "Mutations in ATP-sensitive K+ channel genes cause transient neonatal diabetes and permanent diabetes in childhood or adulthood." Diabetes. 56(7):1930-1937. PMID:17446535
  33. [ + ] Stefanski A, et al. (2007) "The common C49620T polymorphism in the sulfonylurea receptor gene (ABCC8), pancreatic beta cell function and long-term diabetic complications in obese patients with long-lasting type 2 diabetes mellitus." Exp Clin Endocrinol Diabetes. 115(5):317-321. PMID:17516295
  34. [ + ] Zhang H, et al. (2007) "Association of sulfonylurea receptor 1 genotype with therapeutic response to gliclazide in type 2 diabetes." Diabetes Res Clin Pract. 77(1):58-61. PMID:17118480
  35. [ + ] Sakamoto Y, et al. (2007) "SNPs in the KCNJ11-ABCC8 gene locus are associated with type 2 diabetes and blood pressure levels in the Japanese population." J Hum Genet. 52(10):781-793. PMID:17823772
  36. [ + ] Stanik J, et al. (2007) "Prevalence of permanent neonatal diabetes in Slovakia and successful replacement of insulin with sulfonylurea therapy in KCNJ11 and ABCC8 mutation carriers." J Clin Endocrinol Metab. 92(4):1276-1282. PMID:17213273
  37. [ + ] Florez JC, et al. (2007) "Type 2 diabetes-associated missense polymorphisms KCNJ11 E23K and ABCC8 A1369S influence progression to diabetes and response to interventions in the Diabetes Prevention Program." Diabetes. 56(2):531-536. PMID:17259403
  38. [ + ] Dworacka M, et al. (2007) "Impact of the sulfonylurea receptor 1 (SUR1) exon 16-3c/t polymorphism on acute hyperglycaemia in type 2 diabetic patients." Diabetes Res Clin Pract. 77(2):258-262. PMID:17207885
  39. [ + ] Masia R, et al. (2007) "A mutation in the TMD0-L0 region of sulfonylurea receptor-1 (L225P) causes permanent neonatal diabetes mellitus (PNDM)." Diabetes. 56(5):1357-1362. PMID:17317760
  40. [ + ] Patch AM, et al. (2007) "Mutations in the ABCC8 gene encoding the SUR1 subunit of the KATP channel cause transient neonatal diabetes, permanent neonatal diabetes or permanent diabetes diagnosed outside the neonatal period." Diabetes Obes Metab. 9 Suppl 2():28-39. PMID:17919176
  41. [ + ] Greer RM, et al. (2007) "Genotype-phenotype associations in patients with severe hyperinsulinism of infancy." Pediatr Dev Pathol. 10(1):25-34. PMID:17378627
  42. [ + ] Guiot Y, et al. (2007) "Morphological localisation of sulfonylurea receptor 1 in endocrine cells of human, mouse and rat pancreas." Diabetologia. 50(9):1889-1899. PMID:17593344
  43. [ + ] de Wet H, et al. (2007) "Increased ATPase activity produced by mutations at arginine-1380 in nucleotide-binding domain 2 of ABCC8 causes neonatal diabetes." Proc Natl Acad Sci U S A. 104(48):18988-18992. PMID:18025464
  44. [ + ] Natarajan G, et al. (2007) "A novel mutation associated with congenital hyperinsulinism." Am J Perinatol. 24(7):401-404. PMID:17597441
  45. [ + ] Babenko AP, et al. (2006) "Activating mutations in the ABCC8 gene in neonatal diabetes mellitus." N Engl J Med. 355(5):456-466. PMID:16885549
  46. [ + ] Suchi M, et al. (2006) "Molecular and immunohistochemical analyses of the focal form of congenital hyperinsulinism." Mod Pathol. 19(1):122-129. PMID:16357843
  47. [ + ] Gloyn AL, et al. (2006) "Mutations in the genes encoding the pancreatic beta-cell KATP channel subunits Kir6.2 (KCNJ11) and SUR1 (ABCC8) in diabetes mellitus and hyperinsulinism." Hum Mutat. 27(3):220-231. PMID:16416420
  48. [ + ] Fernandez-Marmiesse A, et al. (2006) "Mutation spectra of ABCC8 gene in Spanish patients with Hyperinsulinism of Infancy (HI)." Hum Mutat. 27(2):214. PMID:16429405