0610007P22Rik | GeneID:68327 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 68327 Official Symbol 0610007P22Rik
Locus N/A Gene Type protein-coding
Synonyms 1110014B11Rik; AL022759; MGC113771
Full Name RIKEN cDNA 0610007P22 gene
Description RIKEN cDNA 0610007P22 gene
Chromosome 17 A3.3
Also Known As data source:SPTR, source key:Q9UJK0, evidence:ISS~homolog to human C316G12.2 (NOVEL PROTEIN SIMILAR TO PREDICTED YEAST, WORM AND ARCHAE-BACTERIAL PROTEINS)~putative; hypothetical protein LOC68327
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 6922

ID Symbol Protein Species
GeneID:41849 CG4338 NP_650441.1 Drosophila melanogaster
GeneID:68327 0610007P22Rik NP_080952.1 Mus musculus
GeneID:115939 C16orf42 NP_001001410.1 Homo sapiens
GeneID:176995 F52C12.2 NP_741332.1 Caenorhabditis elegans
GeneID:360494 RGD1565744 XP_340769.3 Rattus norvegicus
GeneID:416590 C16orf42 XP_414890.1 Gallus gallus
GeneID:436643 zgc:92086 NP_001002370.1 Danio rerio
GeneID:479890 LOC479890 XP_537015.1 Canis lupus familiaris
GeneID:508714 C25H16ORF42 XP_585533.1 Bos taurus
GeneID:830871 AT5G10070 NP_974761.1 Arabidopsis thaliana
GeneID:854167 TSR3 NP_014648.1 Saccharomyces cerevisiae
GeneID:1277553 AgaP_AGAP008424 XP_317021.2 Anopheles gambiae
GeneID:2542142 SPAC1F3.04c NP_593007.1 Schizosaccharomyces pombe
GeneID:2674813 MGG_00851 XP_368393.1 Magnaporthe grisea
GeneID:2707891 NCU06104.1 XP_325959.1 Neurospora crassa
GeneID:2892859 KLLA0D01111g XP_453120.1 Kluyveromyces lactis
GeneID:4331931 Os03g0195200 NP_001049256.1 Oryza sativa
GeneID:4619535 AGOS_ACR007W NP_983410.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_026676  UCSC Browser NP_080952

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000063574 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENSMUST00000063574 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENSMUST00000063574 MI0003681 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG
ENSMUST00000063574 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENSMUST00000063574 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENSMUST00000063574 MI0000556 mmu-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSMUST00000063574 MI0000557 mmu-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSMUST00000063574 MI0000561 mmu-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENSMUST00000063574 MI0000562 mmu-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSMUST00000063574 MI0000563 mmu-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSMUST00000063574 MI0000137 mmu-let-7g UGAGGUAGUAGUUUGUACAGUU
ENSMUST00000063574 MI0000153 mmu-miR-126-3p UCGUACCGUGAGUAAUAAUGCG
ENSMUST00000063574 MI0000232 mmu-miR-190 UGAUAUGUUUGAUAUAUUAGGU
ENSMUST00000063574 MI0005478 mmu-miR-190b UGAUAUGUUUGAUAUUGGGUU
ENSMUST00000063574 MI0000698 mmu-miR-214 ACAGCAGGCACAGACAGGCAGU
ENSMUST00000063574 MI0000402 mmu-miR-302a* ACUUAAACGUGGUUGUACUUGC
ENSMUST00000063574 MI0000144 mmu-miR-30a* CUUUCAGUCGGAUGUUUGCAGC
ENSMUST00000063574 MI0000145 mmu-miR-30b UGUAAACAUCCUACACUCAGCU
ENSMUST00000063574 MI0000595 mmu-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
ENSMUST00000063574 MI0000597 mmu-miR-325 UUUAUUGAGCACCUCCUAUCAA
ENSMUST00000063574 MI0000619 mmu-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG
ENSMUST00000063574 MI0000404 mmu-miR-34b-3p AAUCACUAACUCCACUGCCAUC
ENSMUST00000063574 MI0000763 mmu-miR-362-3p AACACACCUGUUCAAGGAUUCA
ENSMUST00000063574 MI0001524 mmu-miR-431* CAGGUCGUCUUGCAGGGCUUCU
ENSMUST00000063574 MI0003491 mmu-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENSMUST00000063574 MI0004258 mmu-miR-672 UGAGGUUGGUGUACUGUGUGUGA
ENSMUST00000063574 MI0004611 mmu-miR-674 GCACUGAGAUGGGAGUGGUGUA
ENSMUST00000063574 MI0004662 mmu-miR-693-3p GCAGCUUUCAGAUGUGGCUGUAA
ENSMUST00000063574 MI0004129 mmu-miR-758 UUUGUGACCUGGUCCACUA
ENSMUST00000063574 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  2. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  7. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  8. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  9. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
  10. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548
  11. [ + ] Harrison SM, et al. (1995) "Isolation of novel tissue-specific genes from cDNA libraries representing the individual tissue constituents of the gastrulating mouse embryo." Development. 121(8):2479-2489. PMID:7671812