0610011L14Rik | GeneID:68295 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 68295 Official Symbol 0610011L14Rik
Locus RP23-55C8.2 Gene Type protein-coding
Synonyms
Full Name RIKEN cDNA 0610011L14 gene
Description RIKEN cDNA 0610011L14 gene
Chromosome 2 H2
Also Known As OTTMUSP00000016925; OTTMUSP00000016926; hypothetical protein LOC68295; novel transcript
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 9170

ID Symbol Protein Species
GeneID:25980 C20orf4 NP_056326.2 Homo sapiens
GeneID:42189 CG12320 NP_650699.1 Drosophila melanogaster
GeneID:68295 0610011L14Rik NP_080937.2 Mus musculus
GeneID:184284 F10B5.2 NP_495708.1 Caenorhabditis elegans
GeneID:296312 RGD1311066 XP_215901.2 Rattus norvegicus
GeneID:419118 C20orf4 NP_001026015.1 Gallus gallus
GeneID:431768 zgc:92018 NP_001002221.1 Danio rerio
GeneID:458215 LOC458215 XP_001166051.1 Pan troglodytes
GeneID:477218 LOC477218 XP_534409.1 Canis lupus familiaris
GeneID:533351 C13H20orf4 NP_001029759.1 Bos taurus
GeneID:842969 AT1G66510 NP_564876.1 Arabidopsis thaliana
GeneID:4335002 Os04g0132300 NP_001052095.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005515 Function protein binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_026661  UCSC Browser NP_080937

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000029158 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSMUST00000029158 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSMUST00000029158 MI0003763 hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU
ENSMUST00000029158 MI0000230 mmu-miR-188-3p CUCCCACAUGCAGGGUUUGCA
ENSMUST00000029158 MI0003476 mmu-miR-489 AAUGACACCACAUAUAUGGCAGC
ENSMUST00000029158 MI0005516 mmu-miR-509-5p UACUCCAGAAUGUGGCAAUCAU
ENSMUST00000029158 MI0003518 mmu-miR-540-3p AGGUCAGAGGUCGAUCCUGG
ENSMUST00000029158 MI0004131 mmu-miR-551b GCGACCCAUACUUGGUUUCAG
ENSMUST00000029158 MI0005004 mmu-miR-615-3p UCCGAGCCUGGGUCUCCCUCUU
ENSMUST00000029158 MI0004646 mmu-miR-683 CCUGCUGUAAGCUGUGUCCUC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Cross M, et al. (2005) "A proteomics strategy for the enrichment of receptor-associated complexes." Proteomics. 5(18):4754-4763. PMID:16267818
  2. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  3. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  4. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  5. [ + ] Watahiki A, et al. (2004) "Libraries enriched for alternatively spliced exons reveal splicing patterns in melanocytes and melanomas." Nat Methods. 1(3):233-239. PMID:15782199
  6. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  7. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  8. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  9. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  10. [ + ] Wertz K, et al. (2000) "Large-scale screen for genes involved in gonad development." Mech Dev. 98(1-2):51-70. PMID:11044607
  11. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  12. [ + ] Tanaka TS, et al. (2000) "Genome-wide expression profiling of mid-gestation placenta and embryo using a 15,000 mouse developmental cDNA microarray." Proc Natl Acad Sci U S A. 97(16):9127-9132. PMID:10922068
  13. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
  14. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548