0610038D11Rik | GeneID:67674 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 67674 Official Symbol 0610038D11Rik
Locus mCG_130245 Gene Type protein-coding
Synonyms Trm112p
Full Name RIKEN cDNA 0610038D11 gene
Description RIKEN cDNA 0610038D11 gene
Chromosome 19 E1
Also Known As TRM112-like
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 41132

ID Symbol Protein Species
GeneID:51504 HSPC152 NP_057488.1 Homo sapiens
GeneID:67674 0610038D11Rik NP_080582.2 Mus musculus
GeneID:293700 RGD1309710 XP_215167.1 Rattus norvegicus
GeneID:466652 LOC466652 XP_001164844.1 Pan troglodytes
GeneID:476033 LOC476033 XP_533242.1 Canis lupus familiaris
GeneID:507833 TRM112L NP_001039446.1 Bos taurus
GeneID:838833 AT1G22270 NP_564163.1 Arabidopsis thaliana
GeneID:844155 AT1G78190 NP_177943.1 Arabidopsis thaliana
GeneID:4343952 Os07g0623000 NP_001060319.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0043234 Component protein complex
GO:0005515 Function protein binding
GO:0008276 Function protein methyltransferase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_026306  UCSC Browser NP_080582

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000088257 MI0005023 bta-miR-545 AUCAACAAACAUUUAUUGUGUG
ENSMUST00000088257 MI0003198 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSMUST00000088257 MI0003199 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSMUST00000088257 MI0003200 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSMUST00000088257 MI0003629 hsa-miR-616 AGUCAUUGGAGGGUUUGAGCAG
ENSMUST00000088257 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENSMUST00000088257 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENSMUST00000088257 MI0005481 mmu-miR-105 CCAAGUGCUCAGAUGCUUGUGGU
ENSMUST00000088257 MI0000406 mmu-miR-106a CAAAGUGCUAACAGUGCAGGUAG
ENSMUST00000088257 MI0000223 mmu-miR-181a-2* ACCGACCGUUGACUGUACCUUG
ENSMUST00000088257 MI0000232 mmu-miR-190 UGAUAUGUUUGAUAUAUUAGGU
ENSMUST00000088257 MI0000233 mmu-miR-191 CAACGGAAUCCCAAAAGCAGCUG
ENSMUST00000088257 MI0000236 mmu-miR-194 UGUAACAGCAACUCCAUGUGGA
ENSMUST00000088257 MI0000733 mmu-miR-194 UGUAACAGCAACUCCAUGUGGA
ENSMUST00000088257 MI0000698 mmu-miR-214 ACAGCAGGCACAGACAGGCAGU
ENSMUST00000088257 MI0000573 mmu-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSMUST00000088257 MI0000706 mmu-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSMUST00000088257 MI0000575 mmu-miR-26b UUCAAGUAAUUCAGGAUAGGU
ENSMUST00000088257 MI0000142 mmu-miR-27b* AGAGCUUAGCUGAUUGGUGAAC
ENSMUST00000088257 MI0000389 mmu-miR-291a-5p CAUCAAAGUGGAGGCCCUCUCU
ENSMUST00000088257 MI0003539 mmu-miR-291b-5p GAUCAAAGUGGAGGCCCUCUCC
ENSMUST00000088257 MI0000592 mmu-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENSMUST00000088257 MI0000794 mmu-miR-377 AUCACACAAAGGCAACUUUUGU
ENSMUST00000088257 MI0001163 mmu-miR-411 UAGUAGACCGUAUAGCGUACG
ENSMUST00000088257 MI0005496 mmu-miR-421 AUCAACAGACAUUAAUUGGGCGC
ENSMUST00000088257 MI0001447 mmu-miR-425 AAUGACACGAUCACUCCCGUUGA
ENSMUST00000088257 MI0001524 mmu-miR-431* CAGGUCGUCUUGCAGGGCUUCU
ENSMUST00000088257 MI0001526 mmu-miR-434-3p UUUGAACCAUCACUCGACUCCU
ENSMUST00000088257 MI0003492 mmu-miR-485* AGUCAUACACGGCUCUCCUCUC
ENSMUST00000088257 MI0003534 mmu-miR-487b AAUCGUACAGGGUCAUCCACUU
ENSMUST00000088257 MI0003476 mmu-miR-489 AAUGACACCACAUAUAUGGCAGC
ENSMUST00000088257 MI0003532 mmu-miR-494 UGAAACAUACACGGGAAACCUC
ENSMUST00000088257 MI0004706 mmu-miR-505 CGUCAACACUUGCUGGUUUUCU
ENSMUST00000088257 MI0003522 mmu-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENSMUST00000088257 MI0004696 mmu-miR-712* UGCGAGUCACCCCCGGGUGUUG
ENSMUST00000088257 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Hoffman BG, et al. (2008) "Identification of transcripts with enriched expression in the developing and adult pancreas." Genome Biol. 9(6):R99. PMID:18554416
  2. [ + ] Figaro S, et al. (2008) "HemK2 protein, encoded on human chromosome 21, methylates translation termination factor eRF1." FEBS Lett. 582(16):2352-2356. PMID:18539146
  3. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  4. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  5. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  6. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  7. [ + ] Mural RJ, et al. (2002) "A comparison of whole-genome shotgun-derived mouse chromosome 16 and the human genome." Science. 296(5573):1661-1671. PMID:12040188
  8. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  9. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  10. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  11. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  12. [ + ] Tanaka TS, et al. (2000) "Genome-wide expression profiling of mid-gestation placenta and embryo using a 15,000 mouse developmental cDNA microarray." Proc Natl Acad Sci U S A. 97(16):9127-9132. PMID:10922068
  13. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
  14. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548