0610009O20Rik | GeneID:66839 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 66839 Official Symbol 0610009O20Rik
Locus N/A Gene Type protein-coding
Synonyms 2700004E22Rik
Full Name RIKEN cDNA 0610009O20 gene
Description RIKEN cDNA 0610009O20 gene
Chromosome 18 B3
Also Known As hypothetical protein LOC66839
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 32232

ID Symbol Protein Species
GeneID:9812 KIAA0141 NP_055588.2 Homo sapiens
GeneID:66839 0610009O20Rik NP_077141.2 Mus musculus
GeneID:307480 RGD735029 NP_955787.1 Rattus norvegicus
GeneID:416192 LOC416192 XP_414519.2 Gallus gallus
GeneID:462153 LOC462153 XP_518004.2 Pan troglodytes
GeneID:487190 LOC487190 XP_544318.2 Canis lupus familiaris
GeneID:513834 KIAA0141 NP_001019706.1 Bos taurus
GeneID:790941 zgc:158257 NP_001073555.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005488 Function binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_024179  UCSC Browser NP_077141

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000025314 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENSMUST00000025314 MI0003679 hsa-miR-549 UGACAACUAUGGAUGAGCUCU
ENSMUST00000025314 MI0003569 hsa-miR-563 AGGUUGACAUACGUUUCCC
ENSMUST00000025314 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENSMUST00000025314 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENSMUST00000025314 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENSMUST00000025314 MI0000171 mmu-miR-149 UCUGGCUCCGUGUCUUCACUCCC
ENSMUST00000025314 MI0000173 mmu-miR-151-3p CUAGACUGAGGCUCCUUGAGG
ENSMUST00000025314 MI0000551 mmu-miR-192 CUGACCUAUGAAUUGACAGCC
ENSMUST00000025314 MI0000235 mmu-miR-193 AACUGGCCUACAAAGUCCCAGU
ENSMUST00000025314 MI0000235 mmu-miR-193* UGGGUCUUUGCGGGCAAGAUGA
ENSMUST00000025314 MI0005484 mmu-miR-193b AACUGGCCCACAAAGUCCCGCU
ENSMUST00000025314 MI0000246 mmu-miR-203* AGUGGUUCUUGACAGUUCAACA
ENSMUST00000025314 MI0000568 mmu-miR-20a* ACUGCAUUACGAGCACUUAAAG
ENSMUST00000025314 MI0000974 mmu-miR-215 AUGACCUAUGAUUUGACAGAC
ENSMUST00000025314 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENSMUST00000025314 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENSMUST00000025314 MI0000391 mmu-miR-293* ACUCAAACUGUGUGACAUUUUG
ENSMUST00000025314 MI0000597 mmu-miR-325 UUUAUUGAGCACCUCCUAUCAA
ENSMUST00000025314 MI0000625 mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENSMUST00000025314 MI0000632 mmu-miR-345-3p CCUGAACUAGGGGUCUGGAGAC
ENSMUST00000025314 MI0000634 mmu-miR-346 UGUCUGCCCGAGUGCCUGCCUCU
ENSMUST00000025314 MI0000796 mmu-miR-379 UGGUAGACUAUGGAACGUAGG
ENSMUST00000025314 MI0001164 mmu-miR-412 UUCACCUGGUCCACUAGCCG
ENSMUST00000025314 MI0001649 mmu-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENSMUST00000025314 MI0003491 mmu-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENSMUST00000025314 MI0004703 mmu-miR-501-5p AAUCCUUUGUCCCUGGGUGAAA
ENSMUST00000025314 MI0004650 mmu-miR-686 AUUGCUUCCCAGACGGUGAAGA
ENSMUST00000025314 MI0004652 mmu-miR-687 CUAUCCUGGAAUGCAGCAAUGA
ENSMUST00000025314 MI0005550 mmu-miR-873 GCAGGAACUUGUGAGUCUCCU
ENSMUST00000025314 MI0005472 mmu-miR-879* GCUUAUGGCUUCAAGCUUUCGG
ENSMUST00000025314 MI0000147 mmu-miR-99b* CAAGCUCGUGUCUGUGGGUCCG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAH02117   BAB22100   BAC25361   BAC29222   BAD32178   BAE42690   EDL10093   EDL10094   EDL10095   EDL10096   NP_077141   Q3TAH8   Q8BT97   Q8CBJ7   Q99M18   Q9DCV6  

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  2. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  3. [ + ] Okazaki N, et al. (2004) "Prediction of the coding sequences of mouse homologues of KIAA gene: IV. The complete nucleotide sequences of 500 mouse KIAA-homologous cDNAs identified by screening of terminal sequences of cDNA clones randomly sampled from size-fractionated libraries." DNA Res. 11(3):205-218. PMID:15368895
  4. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  7. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  8. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  9. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
  10. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548