Gm7816 | GeneID:665839 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 665839 Official Symbol Gm7816
Locus N/A Gene Type protein-coding
Synonyms EG665839
Full Name predicted gene 7816
Description predicted gene 7816
Chromosome 5 B3
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 121375

ID Symbol Protein Species
GeneID:474576 LOC474576 XP_531805.2 Canis lupus familiaris
GeneID:665839 EG665839 XP_984887.1 Mus musculus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_979793  UCSC Browser XP_984887

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000030118 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENSMUST00000030118 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSMUST00000030118 MI0000403 mmu-miR-34c* AAUCACUAACCACACAGCCAGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_979793  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene