Gm7792 | GeneID:665802 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 665802 Official Symbol Gm7792
Locus N/A Gene Type protein-coding
Synonyms EG665802
Full Name predicted gene 7792
Description predicted gene 7792
Chromosome 5 E3|5
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 103898

ID Symbol Protein Species
GeneID:320549 D5Ertd577e NP_796161.1 Mus musculus
GeneID:381654 C87414 XP_001475899.1 Mus musculus
GeneID:545762 AU018829 NP_001026793.1 Mus musculus
GeneID:665290 LOC665290 XP_982246.1 Mus musculus
GeneID:665718 LOC665718 XP_001487848.1 Mus musculus
GeneID:665802 EG665802 XP_986985.1 Mus musculus
GeneID:665943 E330014E10Rik XP_987602.1 Mus musculus
GeneID:100038995 LOC100038995 XP_001472106.1 Mus musculus
GeneID:100039010 LOC100039010 XP_001472219.1 Mus musculus
GeneID:100040112 LOC100040112 XP_001474300.1 Mus musculus
GeneID:100040125 LOC100040125 XP_001474377.1 Mus musculus
GeneID:100040885 LOC100040885 XP_001475817.1 Mus musculus
GeneID:100041032 100041032 XP_001476166.1 Mus musculus
GeneID:100041102 100041102 XP_001476290.1 Mus musculus
GeneID:100041179 100041179 XP_001476464.1 Mus musculus
GeneID:100041253 LOC100041253 XP_001476555.1 Mus musculus
GeneID:100041296 100041296 XP_001476624.1 Mus musculus
GeneID:100041354 100041354 XP_001476843.1 Mus musculus
GeneID:100041641 LOC100041641 XP_001473615.1 Mus musculus
GeneID:100041712 LOC100041712 XP_001473761.1 Mus musculus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_981847  UCSC Browser XP_986941
2 XM_981891  UCSC Browser XP_986985

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000101023 MI0003171 hsa-miR-518d-5p CUCUAGAGGGAAGCACUUUCUG
ENSMUST00000101023 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENSMUST00000101023 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENSMUST00000101023 MI0000579 mmu-miR-31 AGGCAAGAUGCUGGCAUAGCUG
ENSMUST00000101023 MI0001162 mmu-miR-376b* GUGGAUAUUCCUUCUAUGGUUA
ENSMUST00000101023 MI0003533 mmu-miR-376c* GUGGAUAUUCCUUCUAUGUUUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene