LOC665788 | GeneID:665788 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 665788 Official Symbol LOC665788
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description similar to spermiogenesis specific transcript on the Y 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 86509

ID Symbol Protein Species
GeneID:622538 LOC622538 XP_488482.4 Mus musculus
GeneID:665508 LOC665508 XP_982462.1 Mus musculus
GeneID:665788 LOC665788 XP_984547.1 Mus musculus
GeneID:100039040 LOC100039040 XP_001472190.1 Mus musculus
GeneID:100039737 LOC100039737 XP_001473458.1 Mus musculus
GeneID:100039793 LOC100039793 XP_001473177.1 Mus musculus
GeneID:100039877 LOC100039877 XP_001473486.1 Mus musculus
GeneID:100039933 LOC100039933 XP_001473853.1 Mus musculus
GeneID:100040461 LOC100040461 XP_001474108.1 Mus musculus
GeneID:100040468 LOC100040468 XP_001474217.1 Mus musculus
GeneID:100040539 LOC100040539 XP_001474932.1 Mus musculus
GeneID:100040553 LOC100040553 XP_001474449.1 Mus musculus
GeneID:100040758 LOC100040758 XP_001474979.1 Mus musculus
GeneID:100040845 LOC100040845 XP_001475060.1 Mus musculus
GeneID:100041055 LOC100041055 XP_001475375.1 Mus musculus
GeneID:100041275 LOC100041275 XP_001475622.1 Mus musculus
GeneID:100041387 LOC100041387 XP_001476353.1 Mus musculus
GeneID:100041410 LOC100041410 XP_001476393.1 Mus musculus
GeneID:100041435 LOC100041435 XP_001476426.1 Mus musculus
GeneID:100041467 LOC100041467 XP_001475800.1 Mus musculus
GeneID:100041475 LOC100041475 XP_001476486.1 Mus musculus
GeneID:100041657 LOC100041657 XP_001476817.1 Mus musculus
GeneID:100041699 LOC100041699 XP_001476171.1 Mus musculus
GeneID:100041731 LOC100041731 XP_001476227.1 Mus musculus
GeneID:100041807 LOC100041807 XP_001476258.1 Mus musculus
GeneID:100041829 LOC100041829 XP_001476437.1 Mus musculus
GeneID:100041991 LOC100041991 XP_001476628.1 Mus musculus
GeneID:100042015 LOC100042015 XP_001477444.1 Mus musculus
GeneID:100042106 LOC100042106 XP_001477632.1 Mus musculus
GeneID:100042123 LOC100042123 XP_001477087.1 Mus musculus
GeneID:100042316 LOC100042316 XP_001477271.1 Mus musculus
GeneID:100042334 LOC100042334 XP_001478020.1 Mus musculus
GeneID:100042365 LOC100042365 XP_001477356.1 Mus musculus
GeneID:100042381 LOC100042381 XP_001477598.1 Mus musculus
GeneID:100042501 LOC100042501 XP_001477844.1 Mus musculus
GeneID:100042541 LOC100042541 XP_001478012.1 Mus musculus
GeneID:100042696 LOC100042696 XP_001478064.1 Mus musculus
GeneID:100042705 LOC100042705 XP_001478309.1 Mus musculus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001472639  UCSC Browser XP_001472689
2 XM_001487820  UCSC Browser XP_001487870
3 XM_979453  UCSC Browser XP_984547

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000100095 MI0003624 hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC
ENSMUST00000100095 MI0005760 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU
ENSMUST00000100095 MI0000224 mmu-miR-182 UUUGGCAAUGGUAGAACUCACACCG
ENSMUST00000100095 MI0000245 mmu-miR-202-5p UUCCUAUGCAUAUACUUCUUU
ENSMUST00000100095 MI0000702 mmu-miR-219 UGAUUGUCCAAACGCAAUUCU
ENSMUST00000100095 MI0000741 mmu-miR-219 UGAUUGUCCAAACGCAAUUCU
ENSMUST00000100095 MI0000144 mmu-miR-30a* CUUUCAGUCGGAUGUUUGCAGC
ENSMUST00000100095 MI0000259 mmu-miR-30e* CUUUCAGUCGGAUGUUUACAGC
ENSMUST00000100095 MI0000607 mmu-miR-330* GCAAAGCACAGGGCCUGCAGAGA
ENSMUST00000100095 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENSMUST00000100095 MI0003484 mmu-miR-483 AAGACGGGAGAAGAGAAGGGAG
ENSMUST00000100095 MI0004684 mmu-miR-700 CACGCGGGAACCGAGUCCACC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP