Zscan4b | GeneID:665780 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 665780 Official Symbol Zscan4b
Locus N/A Gene Type protein-coding
Synonyms EG665780
Full Name zinc finger and SCAN domain containing 4B
Description zinc finger and SCAN domain containing 4B
Chromosome 7 A1
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 85986

ID Symbol Protein Species
GeneID:245109 Zscan4c NP_001013787.1 Mus musculus
GeneID:545912 Zscan4-ps1 XP_896291.1 Mus musculus
GeneID:545913 Zscan4d XP_620418.1 Mus musculus
GeneID:665780 Zscan4b XP_984497.1 Mus musculus
GeneID:665848 Zscan4e XP_984944.1 Mus musculus
GeneID:665902 Zscan4f XP_001479607.1 Mus musculus
GeneID:665913 Zscan4-ps2 XP_001479626.1 Mus musculus
GeneID:100043042 100043042 XP_001479660.1 Mus musculus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0007566 Process embryo implantation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_979403  UCSC Browser XP_984497

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000067210 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENSMUST00000067210 MI0003167 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENSMUST00000067210 MI0003172 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENSMUST00000067210 MI0003564 hsa-miR-558 UGAGCUGCUGUACCAAAAU
ENSMUST00000067210 MI0003583 hsa-miR-576-5p AUUCUAAUUUCUCCACGUCUUU
ENSMUST00000067210 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENSMUST00000067210 MI0003605 hsa-miR-593 UGUCUCUGCUGGGGUUUCU
ENSMUST00000067210 MI0003642 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA
ENSMUST00000067210 MI0003656 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC
ENSMUST00000067210 MI0005767 hsa-miR-942 UCUUCUCUGUUUUGGCCAUGUG
ENSMUST00000067210 MI0000154 mmu-miR-127* CUGAAGCUCAGAGGGCUCUGAU
ENSMUST00000067210 MI0000166 mmu-miR-141 UAACACUGUCUGGUAAAGAUGG
ENSMUST00000067210 MI0000257 mmu-miR-143 UGAGAUGAAGCACUGUAGCUC
ENSMUST00000067210 MI0000554 mmu-miR-200a UAACACUGUCUGGUAACGAUGU
ENSMUST00000067210 MI0000694 mmu-miR-200c UAAUACUGCCGGGUAAUGAUGGA
ENSMUST00000067210 MI0000570 mmu-miR-22 AAGCUGCCAGUUGAAGAACUGU
ENSMUST00000067210 MI0000145 mmu-miR-30b* CUGGGAUGUGGAUGUUUACGUC
ENSMUST00000067210 MI0000623 mmu-miR-340-5p UUAUAAAGCAAUGAGACUGAUU
ENSMUST00000067210 MI0000584 mmu-miR-34a UGGCAGUGUCUUAGCUGGUUGU
ENSMUST00000067210 MI0000404 mmu-miR-34b-5p AGGCAGUGUAAUUAGCUGAUUGU
ENSMUST00000067210 MI0000403 mmu-miR-34c AGGCAGUGUAGUUAGCUGAUUGC
ENSMUST00000067210 MI0004125 mmu-miR-374* GGUUGUAUUAUCAUUGUCCGAG
ENSMUST00000067210 MI0000800 mmu-miR-383 AGAUCAGAAGGUGACUGUGGCU
ENSMUST00000067210 MI0001163 mmu-miR-411 UAGUAGACCGUAUAGCGUACG
ENSMUST00000067210 MI0001649 mmu-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENSMUST00000067210 MI0005547 mmu-miR-449b AGGCAGUGUUGUUAGCUGGC
ENSMUST00000067210 MI0004645 mmu-miR-449c AGGCAGUGCAUUGCUAGCUGG
ENSMUST00000067210 MI0004679 mmu-miR-455 GCAGUCCACGGGCAUAUACAC
ENSMUST00000067210 MI0002405 mmu-miR-470 UUCUUGGACUGGCACUGGUGAGU
ENSMUST00000067210 MI0004676 mmu-miR-499 UUAAGACUUGCAGUGAUGUUU
ENSMUST00000067210 MI0003520 mmu-miR-539 GGAGAAAUUAUCCUUGGUGUGU
ENSMUST00000067210 MI0005520 mmu-miR-654-3p UAUGUCUGCUGACCAUCACCUU
ENSMUST00000067210 MI0005520 mmu-miR-654-5p UGGUAAGCUGCAGAACAUGUGU
ENSMUST00000067210 MI0004258 mmu-miR-672 UGAGGUUGGUGUACUGUGUGUGA
ENSMUST00000067210 MI0004660 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENSMUST00000067210 MI0004661 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENSMUST00000067210 MI0005207 mmu-miR-743a GAAAGACACCAAGCUGAGUAGA
ENSMUST00000067210 MI0005470 mmu-miR-743b-3p GAAAGACAUCAUGCUGAAUAGA
ENSMUST00000067210 MI0000157 mmu-miR-9* AUAAAGCUAGAUAACCGAAAGU
ENSMUST00000067210 MI0000720 mmu-miR-9* AUAAAGCUAGAUAACCGAAAGU
ENSMUST00000067210 MI0000721 mmu-miR-9* AUAAAGCUAGAUAACCGAAAGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_979403  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Falco G, et al. (2007) "Zscan4: a novel gene expressed exclusively in late 2-cell embryos and embryonic stem cells." Dev Biol. 307(2):539-550. PMID:17553482