Bod1l | GeneID:665775 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 665775 Official Symbol Bod1l
Locus N/A Gene Type protein-coding
Synonyms A230054D04Rik; AI853319; FAM44A; mKIAA1327
Full Name biorientation of chromosomes in cell division 1-like
Description biorientation of chromosomes in cell division 1-like
Chromosome 5 B3
Also Known As family with sequence similarity 44, member A
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 45109

ID Symbol Protein Species
GeneID:259282 FAM44A NP_683692.2 Homo sapiens
GeneID:422838 FAM44A XP_420784.2 Gallus gallus
GeneID:479089 LOC479089 XP_536235.2 Canis lupus familiaris
GeneID:508527 LOC508527 XP_585315.3 Bos taurus
GeneID:665775 A230054D04Rik NP_001074891.1 Mus musculus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001081422  UCSC Browser NP_001074891

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000050556 MI0003160 hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU
ENSMUST00000050556 MI0003152 hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG
ENSMUST00000050556 MI0003656 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC
ENSMUST00000050556 MI0005533 hsa-miR-890 UACUUGGAAAGGCAUCAGUUG
ENSMUST00000050556 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG
ENSMUST00000050556 MI0000551 mmu-miR-192 CUGACCUAUGAAUUGACAGCC
ENSMUST00000050556 MI0000554 mmu-miR-200a* CAUCUUACCGGACAGUGCUGGA
ENSMUST00000050556 MI0000710 mmu-miR-222 AGCUACAUCUGGCUACUGGGU
ENSMUST00000050556 MI0000575 mmu-miR-26b* CCUGUUCUCCAUUACUUGGCUC
ENSMUST00000050556 MI0000632 mmu-miR-345-3p CCUGAACUAGGGGUCUGGAGAC
ENSMUST00000050556 MI0000632 mmu-miR-345-5p GCUGACCCCUAGUCCAGUGCUU
ENSMUST00000050556 MI0001525 mmu-miR-433* UACGGUGAGCCUGUCAUUAUUC
ENSMUST00000050556 MI0002403 mmu-miR-468 UAUGACUGAUGUGCGUGUGUCUG
ENSMUST00000050556 MI0005554 mmu-miR-511 AUGCCUUUUGCUCUGCACUCA
ENSMUST00000050556 MI0004692 mmu-miR-708 AAGGAGCUUACAAUCUAGCUGGG
ENSMUST00000050556 MI0004704 mmu-miR-717 CUCAGACAGAGAUACCUUCUCU
ENSMUST00000050556 MI0004129 mmu-miR-758 UUUGUGACCUGGUCCACUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  2. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  3. [ + ] Okazaki N, et al. (2003) "Prediction of the coding sequences of mouse homologues of KIAA gene: II. The complete nucleotide sequences of 400 mouse KIAA-homologous cDNAs identified by screening of terminal sequences of cDNA clones randomly sampled from size-fractionated libraries." DNA Res. 10(1):35-48. PMID:12693553
  4. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  7. [ + ] Piao Y, et al. (2001) "Construction of long-transcript enriched cDNA libraries from submicrogram amounts of total RNAs by a universal PCR amplification method." Genome Res. 11(9):1553-1558. PMID:11544199
  8. [ + ] Tanaka TS, et al. (2000) "Genome-wide expression profiling of mid-gestation placenta and embryo using a 15,000 mouse developmental cDNA microarray." Proc Natl Acad Sci U S A. 97(16):9127-9132. PMID:10922068
  9. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  10. [ + ] Ko MS, et al. (2000) "Large-scale cDNA analysis reveals phased gene expression patterns during preimplantation mouse development." Development. 127(8):1737-1749. PMID:10725249
  11. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  12. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
  13. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548
  14. [ + ] Benayahu D, et al. (1995) "Monoclonal antibodies recognize antigen expressed by osteoblasts." J Bone Miner Res. 10(10):1496-1503. PMID:8686505