Gm7779 | GeneID:665769 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 665769 Official Symbol Gm7779
Locus N/A Gene Type protein-coding
Synonyms 665769
Full Name predicted gene 7779
Description predicted gene 7779
Chromosome 15 D1|15
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 86419

ID Symbol Protein Species
GeneID:314959 RGD1359449 NP_001014106.1 Rattus norvegicus
GeneID:665769 665769 XP_984438.1 Mus musculus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_979344  UCSC Browser XP_984438

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000071847 MI0003561 hsa-miR-555 AGGGUAAGCUGAACCUCUGAU
ENSMUST00000071847 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENSMUST00000071847 MI0003611 hsa-miR-599 GUUGUGUCAGUUUAUCAAAC
ENSMUST00000071847 MI0003643 hsa-miR-629 UGGGUUUACGUUGGGAGAACU
ENSMUST00000071847 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENSMUST00000071847 MI0003664 hsa-miR-649 AAACCUGUGUUGUUCAAGAGUC
ENSMUST00000071847 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENSMUST00000071847 MI0000137 mmu-let-7g* ACUGUACAGGCCACUGCCUUGC
ENSMUST00000071847 MI0000166 mmu-miR-141* CAUCUUCCAGUGCAGUGUUGGA
ENSMUST00000071847 MI0005482 mmu-miR-147 GUGUGCGGAAAUGCUUCUGCUA
ENSMUST00000071847 MI0000176 mmu-miR-154 UAGGUUAUCCGUGUUGCCUUCG
ENSMUST00000071847 MI0000235 mmu-miR-193* UGGGUCUUUGCGGGCAAGAUGA
ENSMUST00000071847 MI0000243 mmu-miR-200b* CAUCUUACUGGGCAGCAUUGGA
ENSMUST00000071847 MI0000699 mmu-miR-216a UAAUCUCAGCUGGCAACUGUGA
ENSMUST00000071847 MI0000231 mmu-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSMUST00000071847 MI0000572 mmu-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSMUST00000071847 MI0000590 mmu-miR-322* AAACAUGAAGCGCUGCAACAC
ENSMUST00000071847 MI0000595 mmu-miR-324-3p CCACUGCCCCAGGUGCUGCU
ENSMUST00000071847 MI0000615 mmu-miR-337-3p UUCAGCUCCUAUAUGAUGCCU
ENSMUST00000071847 MI0000615 mmu-miR-337-5p GAACGGCGUCAUGCAGGAGUU
ENSMUST00000071847 MI0000765 mmu-miR-363 AAUUGCACGGUAUCCAUCUGUA
ENSMUST00000071847 MI0000796 mmu-miR-379 UGGUAGACUAUGGAACGUAGG
ENSMUST00000071847 MI0001524 mmu-miR-431 UGUCUUGCAGGCCGUCAUGCA
ENSMUST00000071847 MI0001524 mmu-miR-431* CAGGUCGUCUUGCAGGGCUUCU
ENSMUST00000071847 MI0005515 mmu-miR-504 AGACCCUGGUCUGCACUCUAUC
ENSMUST00000071847 MI0005003 mmu-miR-676* ACUCUACAACCUUAGGACUUGC
ENSMUST00000071847 MI0004643 mmu-miR-681 CAGCCUCGCUGGCAGGCAGCU
ENSMUST00000071847 MI0004647 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENSMUST00000071847 MI0004648 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENSMUST00000071847 MI0004662 mmu-miR-693-3p GCAGCUUUCAGAUGUGGCUGUAA
ENSMUST00000071847 MI0004675 mmu-miR-695 AGAUUGGGCAUAGGUGACUGAA
ENSMUST00000071847 MI0004686 mmu-miR-702 UGCCCACCCUUUACCCCGCUC
ENSMUST00000071847 MI0004690 mmu-miR-706 AGAGAAACCCUGUCUCAAAAAA
ENSMUST00000071847 MI0004124 mmu-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENSMUST00000071847 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENSMUST00000071847 MI0005474 mmu-miR-881 AACUGUGUCUUUUCUGAAUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_979344  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene