LOC665755 | GeneID:665755 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 665755 Official Symbol LOC665755
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description similar to CDNA sequence BC061212
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 77633

ID Symbol Protein Species
GeneID:331195 A430089I19Rik NP_808581.1 Mus musculus
GeneID:381724 BC061212 NP_941069.1 Mus musculus
GeneID:501896 RGD1565660 XP_577319.2 Rattus norvegicus
GeneID:501937 LOC501937 XP_577363.1 Rattus norvegicus
GeneID:545763 EG545763 XP_620207.1 Mus musculus
GeneID:664941 EG664941 XP_978593.1 Mus musculus
GeneID:665020 EG665020 XP_979123.1 Mus musculus
GeneID:665755 LOC665755 XP_984325.1 Mus musculus
GeneID:666187 666187 XP_987278.1 Mus musculus
GeneID:666203 EG666203 XP_987388.1 Mus musculus
GeneID:100040981 LOC100040981 XP_001476078.1 Mus musculus
GeneID:100041042 LOC100041042 XP_001476214.1 Mus musculus
GeneID:100041115 100041115 XP_001476360.1 Mus musculus
GeneID:100041264 ENSMUSG00000072817 XP_001476598.1 Mus musculus
GeneID:100041837 LOC100041837 XP_001474094.1 Mus musculus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_979231  UCSC Browser XP_984325

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000092582 MI0003195 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG
ENSMUST00000092582 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENSMUST00000092582 MI0003154 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG
ENSMUST00000092582 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENSMUST00000092582 MI0003152 hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU
ENSMUST00000092582 MI0003630 hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC
ENSMUST00000092582 MI0003567 hsa-miR-561 CAAAGUUUAAGAUCCUUGAAGU
ENSMUST00000092582 MI0003577 hsa-miR-570 CGAAAACAGCAAUUACCUUUGC
ENSMUST00000092582 MI0003579 hsa-miR-572 GUCCGCUCGGCGGUGGCCCA
ENSMUST00000092582 MI0003583 hsa-miR-576-5p AUUCUAAUUUCUCCACGUCUUU
ENSMUST00000092582 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSMUST00000092582 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENSMUST00000092582 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENSMUST00000092582 MI0005537 hsa-miR-888 UACUCAAAAAGCUGUCAGUCA
ENSMUST00000092582 MI0005714 hsa-miR-922 GCAGCAGAGAAUAGGACUACGUC
ENSMUST00000092582 MI0005760 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU
ENSMUST00000092582 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG
ENSMUST00000092582 MI0000152 mmu-miR-125b* ACAAGUCAGGUUCUUGGGACCU
ENSMUST00000092582 MI0000550 mmu-miR-148a* AAAGUUCUGAGACACUCCGACU
ENSMUST00000092582 MI0000223 mmu-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSMUST00000092582 MI0000697 mmu-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSMUST00000092582 MI0000723 mmu-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSMUST00000092582 MI0000823 mmu-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSMUST00000092582 MI0000724 mmu-miR-181c AACAUUCAACCUGUCGGUGAGU
ENSMUST00000092582 MI0005450 mmu-miR-181d AACAUUCAUUGUUGUCGGUGGGU
ENSMUST00000092582 MI0000703 mmu-miR-223 UGUCAGUUUGUCAAAUACCCCA
ENSMUST00000092582 MI0000621 mmu-miR-339-3p UGAGCGCCUCGGCGACAGAGCCG
ENSMUST00000092582 MI0000630 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENSMUST00000092582 MI0005495 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENSMUST00000092582 MI0000795 mmu-miR-378* CUCCUGACUCCAGGUCCUGUGU
ENSMUST00000092582 MI0005497 mmu-miR-453 AGGUUGCCUCAUAGUGAGCUUGCA
ENSMUST00000092582 MI0004679 mmu-miR-455 GCAGUCCACGGGCAUAUACAC
ENSMUST00000092582 MI0005516 mmu-miR-509-5p UACUCCAGAAUGUGGCAAUCAU
ENSMUST00000092582 MI0003519 mmu-miR-543 AAACAUUCGCGGUGCACUUCUU
ENSMUST00000092582 MI0004133 mmu-miR-671-3p UCCGGUUCUCAGGGCUCCACC
ENSMUST00000092582 MI0004681 mmu-miR-697 AACAUCCUGGUCCUGUGGAGA
ENSMUST00000092582 MI0004688 mmu-miR-704 AGACAUGUGCUCUGCUCCUAG
ENSMUST00000092582 MI0004696 mmu-miR-712* UGCGAGUCACCCCCGGGUGUUG
ENSMUST00000092582 MI0005205 mmu-miR-741 UGAGAGAUGCCAUUCUAUGUAGA
ENSMUST00000092582 MI0005548 mmu-miR-878-5p UAUCUAGUUGGAUGUCAAGACA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_979231  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene