Eif5al3 | GeneID:665733 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 665733 Official Symbol Eif5al3
Locus N/A Gene Type protein-coding
Synonyms EG665733
Full Name eukaryotic translation initiation factor 5A-like 3
Description eukaryotic translation initiation factor 5A-like 3
Chromosome 5 E1
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 108156

ID Symbol Protein Species
GeneID:143244 EIF5AL1 NP_001093162.1 Homo sapiens
GeneID:665733 Eif5al3 XP_984172.2 Mus musculus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001472647  UCSC Browser XP_001472697
2 XM_979078  UCSC Browser XP_984172

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000055731 MI0003197 hsa-miR-510 UACUCAGGAGAGUGGCAAUCAC
ENSMUST00000055731 MI0003643 hsa-miR-629 UGGGUUUACGUUGGGAGAACU
ENSMUST00000055731 MI0003654 hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU
ENSMUST00000055731 MI0005763 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSMUST00000055731 MI0005764 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSMUST00000055731 MI0005765 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSMUST00000055731 MI0005766 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSMUST00000055731 MI0000153 mmu-miR-126-5p CAUUAUUACUUUUGGUACGCG
ENSMUST00000055731 MI0000693 mmu-miR-139-5p UCUACAGUGCACGUGUCUCCAG
ENSMUST00000055731 MI0000723 mmu-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSMUST00000055731 MI0000823 mmu-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSMUST00000055731 MI0000236 mmu-miR-194 UGUAACAGCAACUCCAUGUGGA
ENSMUST00000055731 MI0000733 mmu-miR-194 UGUAACAGCAACUCCAUGUGGA
ENSMUST00000055731 MI0005485 mmu-miR-197 UUCACCACCUUCUCCACCCAGC
ENSMUST00000055731 MI0000241 mmu-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENSMUST00000055731 MI0000713 mmu-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENSMUST00000055731 MI0000573 mmu-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSMUST00000055731 MI0000706 mmu-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSMUST00000055731 MI0000575 mmu-miR-26b UUCAAGUAAUUCAGGAUAGGU
ENSMUST00000055731 MI0000404 mmu-miR-34b-5p AGGCAGUGUAAUUAGCUGAUUGU
ENSMUST00000055731 MI0000403 mmu-miR-34c AGGCAGUGUAGUUAGCUGAUUGC
ENSMUST00000055731 MI0002398 mmu-miR-463* UACCUAAUUUGUUGUCCAUCAU
ENSMUST00000055731 MI0004640 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSMUST00000055731 MI0004641 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSMUST00000055731 MI0004642 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSMUST00000055731 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSMUST00000055731 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSMUST00000055731 MI0004124 mmu-miR-744* CUGUUGCCACUAACCUCAACCU
ENSMUST00000055731 MI0005553 mmu-miR-877* UGUCCUCUUCUCCCUCCUCCCA
ENSMUST00000055731 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU
ENSMUST00000055731 MI0005477 mmu-miR-883b-3p UAACUGCAACAUCUCUCAGUAU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene