Gm7757 | GeneID:665719 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 665719 Official Symbol Gm7757
Locus N/A Gene Type protein-coding
Synonyms EG665719
Full Name predicted gene 7757
Description predicted gene 7757
Chromosome 9 F3
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 114393

ID Symbol Protein Species
GeneID:77049 4921528I07Rik XP_486266.3 Mus musculus
GeneID:319213 4930579C12Rik NP_783603.1 Mus musculus
GeneID:501031 RGD1560775 XP_576442.2 Rattus norvegicus
GeneID:665719 EG665719 XP_984062.1 Mus musculus
GeneID:100039674 LOC100039674 XP_001473289.1 Mus musculus
GeneID:100039741 100039741 XP_001473380.1 Mus musculus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_978968  UCSC Browser XP_984062

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000072612 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_978968  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene