LOC665718 | GeneID:665718 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 665718 Official Symbol LOC665718
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description similar to C87414 protein
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 103898

ID Symbol Protein Species
GeneID:320549 D5Ertd577e NP_796161.1 Mus musculus
GeneID:381654 C87414 XP_001475899.1 Mus musculus
GeneID:545762 AU018829 NP_001026793.1 Mus musculus
GeneID:665290 LOC665290 XP_982246.1 Mus musculus
GeneID:665718 LOC665718 XP_001487848.1 Mus musculus
GeneID:665802 EG665802 XP_986985.1 Mus musculus
GeneID:665943 E330014E10Rik XP_987602.1 Mus musculus
GeneID:100038995 LOC100038995 XP_001472106.1 Mus musculus
GeneID:100039010 LOC100039010 XP_001472219.1 Mus musculus
GeneID:100040112 LOC100040112 XP_001474300.1 Mus musculus
GeneID:100040125 LOC100040125 XP_001474377.1 Mus musculus
GeneID:100040885 LOC100040885 XP_001475817.1 Mus musculus
GeneID:100041032 100041032 XP_001476166.1 Mus musculus
GeneID:100041102 100041102 XP_001476290.1 Mus musculus
GeneID:100041179 100041179 XP_001476464.1 Mus musculus
GeneID:100041253 LOC100041253 XP_001476555.1 Mus musculus
GeneID:100041296 100041296 XP_001476624.1 Mus musculus
GeneID:100041354 100041354 XP_001476843.1 Mus musculus
GeneID:100041641 LOC100041641 XP_001473615.1 Mus musculus
GeneID:100041712 LOC100041712 XP_001473761.1 Mus musculus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001487798  UCSC Browser XP_001487848
2 XM_978965  UCSC Browser XP_984059

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000101016 MI0003562 hsa-miR-556-3p AUAUUACCAUUAGCUCAUCUUU
ENSMUST00000101016 MI0003614 hsa-miR-601 UGGUCUAGGAUUGUUGGAGGAG
ENSMUST00000101016 MI0003648 hsa-miR-633 CUAAUAGUAUCUACCACAAUAAA
ENSMUST00000101016 MI0005755 hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC
ENSMUST00000101016 MI0000556 mmu-let-7a* CUAUACAAUCUACUGUCUUUCC
ENSMUST00000101016 MI0000558 mmu-let-7b* CUAUACAACCUACUGCCUUCCC
ENSMUST00000101016 MI0000559 mmu-let-7c-1* CUGUACAACCUUCUAGCUUUCC
ENSMUST00000101016 MI0000158 mmu-miR-132 UAACAGUCUACAGCCAUGGUCG
ENSMUST00000101016 MI0000229 mmu-miR-187 UCGUGUCUUGUGUUGCAGCCGG
ENSMUST00000101016 MI0000554 mmu-miR-200a UAACACUGUCUGGUAACGAUGU
ENSMUST00000101016 MI0000696 mmu-miR-212 UAACAGUCUCCAGUCACGGCCA
ENSMUST00000101016 MI0000711 mmu-miR-224 UAAGUCACUAGUGGUUCCGUU
ENSMUST00000101016 MI0000578 mmu-miR-27a UUCACAGUGGCUAAGUUCCGC
ENSMUST00000101016 MI0000142 mmu-miR-27b UUCACAGUGGCUAAGUUCUGC
ENSMUST00000101016 MI0000144 mmu-miR-30a* CUUUCAGUCGGAUGUUUGCAGC
ENSMUST00000101016 MI0000547 mmu-miR-30c-1* CUGGGAGAGGGUUGUUUACUCC
ENSMUST00000101016 MI0000259 mmu-miR-30e* CUUUCAGUCGGAUGUUUACAGC
ENSMUST00000101016 MI0000609 mmu-miR-331-3p GCCCCUGGGCCUAUCCUAGAA
ENSMUST00000101016 MI0000621 mmu-miR-339-3p UGAGCGCCUCGGCGACAGAGCCG
ENSMUST00000101016 MI0000623 mmu-miR-340-3p UCCGUCUCAGUUACUUUAUAGC
ENSMUST00000101016 MI0000623 mmu-miR-340-5p UUAUAAAGCAAUGAGACUGAUU
ENSMUST00000101016 MI0001649 mmu-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENSMUST00000101016 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENSMUST00000101016 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENSMUST00000101016 MI0005515 mmu-miR-504 AGACCCUGGUCUGCACUCUAUC
ENSMUST00000101016 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG
ENSMUST00000101016 MI0005205 mmu-miR-741 UGAGAGAUGCCAUUCUAUGUAGA
ENSMUST00000101016 MI0005473 mmu-miR-880 UACUCCAUCCUCUCUGAGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene