Gm7742 | GeneID:665669 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 665669 Official Symbol Gm7742
Locus N/A Gene Type protein-coding
Synonyms EG665669
Full Name predicted gene 7742
Description predicted gene 7742
Chromosome 17 A3.2
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 87112

ID Symbol Protein Species
GeneID:75011 4930488N24Rik XP_619430.4 Mus musculus
GeneID:627924 EG627924 XP_897723.1 Mus musculus
GeneID:631010 631010 XP_001478666.1 Mus musculus
GeneID:635895 EG635895 XP_977895.1 Mus musculus
GeneID:664821 EG664821 XP_977970.2 Mus musculus
GeneID:664831 EG664831 XP_978062.2 Mus musculus
GeneID:665654 EG665654 XP_983579.2 Mus musculus
GeneID:665662 EG665662 XP_983608.2 Mus musculus
GeneID:665669 EG665669 XP_983688.2 Mus musculus
GeneID:829221 CIPK6 NP_194825.1 Arabidopsis thaliana
GeneID:4327093 Os01g0206700 NP_001042345.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001478548  UCSC Browser XP_001478598
2 XM_978594  UCSC Browser XP_983688

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000096981 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENSMUST00000096981 MI0000137 mmu-let-7g UGAGGUAGUAGUUUGUACAGUU
ENSMUST00000096981 MI0000162 mmu-miR-136* AUCAUCGUCUCAAAUGAGUCUU
ENSMUST00000096981 MI0000235 mmu-miR-193* UGGGUCUUUGCGGGCAAGAUGA
ENSMUST00000096981 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENSMUST00000096981 MI0002405 mmu-miR-470* AACCAGUACCUUUCUGAGAAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP