Gm7735 | GeneID:665661 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 665661 Official Symbol Gm7735
Locus N/A Gene Type protein-coding
Synonyms EG665661
Full Name predicted gene 7735
Description predicted gene 7735
Chromosome 16 C3.3
Also Known As
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001004297  UCSC Browser XP_001004297
2 XM_978513  UCSC Browser XP_983607

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000089098 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENSMUST00000089098 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSMUST00000089098 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSMUST00000089098 MI0003630 hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC
ENSMUST00000089098 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSMUST00000089098 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSMUST00000089098 MI0000168 mmu-miR-144 UACAGUAUAGAUGAUGUACU
ENSMUST00000089098 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENSMUST00000089098 MI0003533 mmu-miR-376c AACAUAGAGGAAAUUUCACGU
ENSMUST00000089098 MI0001146 mmu-miR-384-3p AUUCCUAGAAAUUGUUCACAAU
ENSMUST00000089098 MI0002403 mmu-miR-468 UAUGACUGAUGUGCGUGUGUCUG
ENSMUST00000089098 MI0004127 mmu-miR-592 AUUGUGUCAAUAUGCGAUGAUGU
ENSMUST00000089098 MI0004659 mmu-miR-691 AUUCCUGAAGAGAGGCAGAAAA
ENSMUST00000089098 MI0000157 mmu-miR-9* AUAAAGCUAGAUAACCGAAAGU
ENSMUST00000089098 MI0000720 mmu-miR-9* AUAAAGCUAGAUAACCGAAAGU
ENSMUST00000089098 MI0000721 mmu-miR-9* AUAAAGCUAGAUAACCGAAAGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP