LOC665622 | GeneID:665622 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 665622 Official Symbol LOC665622
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description H2b histone family member
Chromosome 13 A3.1
Also Known As histone pseudogene
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001110555  UCSC Browser NP_001104025
2 NR_003375  UCSC Browser

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000091744 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENSMUST00000091744 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENSMUST00000091744 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA
ENSMUST00000091744 MI0005476 mmu-miR-883a-5p UGCUGAGAGAAGUAGCAGUUAC
ENSMUST00000091749 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENSMUST00000091749 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENSMUST00000091749 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA
ENSMUST00000091749 MI0005476 mmu-miR-883a-5p UGCUGAGAGAAGUAGCAGUUAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  2. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  3. [ + ] Mural RJ, et al. (2002) "A comparison of whole-genome shotgun-derived mouse chromosome 16 and the human genome." Science. 296(5573):1661-1671. PMID:12040188
  4. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  7. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  8. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  9. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636