RP23-38E20.1 | GeneID:665596 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 665596 Official Symbol RP23-38E20.1
Locus RP23-38E20.1 Gene Type protein-coding
Synonyms OTTMUSG00000013203
Full Name predicted gene, OTTMUSG00000013203
Description predicted gene, OTTMUSG00000013203
Chromosome 13 A3.1
Also Known As H2b histone family, member A
Summary N/A

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005694 Component chromosome
GO:0000786 Component nucleosome
GO:0005634 Component nucleus
GO:0003677 Function DNA binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001097979  UCSC Browser NP_001091448
2 XM_798035  UCSC Browser

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000091744 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENSMUST00000091744 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENSMUST00000091744 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA
ENSMUST00000091744 MI0005476 mmu-miR-883a-5p UGCUGAGAGAAGUAGCAGUUAC
ENSMUST00000091749 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENSMUST00000091749 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENSMUST00000091749 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA
ENSMUST00000091749 MI0005476 mmu-miR-883a-5p UGCUGAGAGAAGUAGCAGUUAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene