Gm7698 | GeneID:665579 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 665579 Official Symbol Gm7698
Locus N/A Gene Type protein-coding
Synonyms EG665579
Full Name predicted gene 7698
Description predicted gene 7698
Chromosome X E3
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 104445

ID Symbol Protein Species
GeneID:313283 RGD1562265 XP_233076.1 Rattus norvegicus
GeneID:391370 LOC391370 XP_372926.3 Homo sapiens
GeneID:434843 EG434843 XP_486761.1 Mus musculus
GeneID:470360 LOC470360 XP_001137507.1 Pan troglodytes
GeneID:626048 EG626048 XP_001473430.1 Mus musculus
GeneID:665463 EG665463 XP_982204.1 Mus musculus
GeneID:665522 EG665522 XP_982634.1 Mus musculus
GeneID:665579 EG665579 XP_983012.1 Mus musculus
GeneID:665611 EG665611 XP_983229.1 Mus musculus
GeneID:100038969 LOC100038969 XP_001472057.1 Mus musculus
GeneID:100038978 LOC100038978 XP_001472169.1 Mus musculus
GeneID:100039828 LOC100039828 XP_001473326.1 Mus musculus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0003674 Function molecular_function
GO:0008150 Process biological_process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_977918  UCSC Browser XP_983012

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000101262 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENSMUST00000101262 MI0003588 hsa-miR-581 UCUUGUGUUCUCUAGAUCAGU
ENSMUST00000101262 MI0000166 mmu-miR-141* CAUCUUCCAGUGCAGUGUUGGA
ENSMUST00000101262 MI0000697 mmu-miR-181a-1* ACCAUCGACCGUUGAUUGUACC
ENSMUST00000101262 MI0000142 mmu-miR-27b* AGAGCUUAGCUGAUUGGUGAAC
ENSMUST00000101262 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENSMUST00000101262 MI0005206 mmu-miR-742* UACUCACAUGGUUGCUAAUCA
ENSMUST00000101262 MI0005548 mmu-miR-878-5p UAUCUAGUUGGAUGUCAAGACA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]


Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene