0910001L09Rik | GeneID:66096 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 66096 Official Symbol 0910001L09Rik
Locus N/A Gene Type protein-coding
Synonyms AV006840
Full Name RIKEN cDNA 0910001L09 gene
Description RIKEN cDNA 0910001L09 gene
Chromosome 5 G2
Also Known As OTTMUSP00000026042; UPF0539 protein; hypothetical protein LOC66096
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 19241

ID Symbol Protein Species
GeneID:66096 0910001L09Rik NP_001074577.1 Mus musculus
GeneID:360776 RGD1309735 XP_341045.2 Rattus norvegicus
GeneID:389541 C7orf59 NP_001008396.1 Homo sapiens
GeneID:479736 LOC479736 XP_536864.1 Canis lupus familiaris
GeneID:511903 LOC511903 XP_589330.2 Bos taurus
GeneID:561019 si:dkey-159a18.7 NP_001038415.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001081108  UCSC Browser NP_001074577

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000062067 MI0003195 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG
ENSMUST00000062067 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSMUST00000062067 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSMUST00000062067 MI0003180 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSMUST00000062067 MI0003181 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSMUST00000062067 MI0003171 hsa-miR-518d-5p CUCUAGAGGGAAGCACUUUCUG
ENSMUST00000062067 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENSMUST00000062067 MI0003152 hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU
ENSMUST00000062067 MI0003557 hsa-miR-552 AACAGGUGACUGGUUAGACAA
ENSMUST00000062067 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENSMUST00000062067 MI0003573 hsa-miR-567 AGUAUGUUCUUCCAGGACAGAAC
ENSMUST00000062067 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENSMUST00000062067 MI0003624 hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC
ENSMUST00000062067 MI0003642 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA
ENSMUST00000062067 MI0003651 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA
ENSMUST00000062067 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENSMUST00000062067 MI0005713 hsa-miR-921 CUAGUGAGGGACAGAACCAGGAUUC
ENSMUST00000062067 MI0005714 hsa-miR-922 GCAGCAGAGAAUAGGACUACGUC
ENSMUST00000062067 MI0005758 hsa-miR-936 ACAGUAGAGGGAGGAAUCGCAG
ENSMUST00000062067 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENSMUST00000062067 MI0005767 hsa-miR-942 UCUUCUCUGUUUUGGCCAUGUG
ENSMUST00000062067 MI0000556 mmu-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSMUST00000062067 MI0000557 mmu-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSMUST00000062067 MI0000558 mmu-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENSMUST00000062067 MI0000559 mmu-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSMUST00000062067 MI0000560 mmu-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSMUST00000062067 MI0000405 mmu-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENSMUST00000062067 MI0000561 mmu-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENSMUST00000062067 MI0000562 mmu-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSMUST00000062067 MI0000563 mmu-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSMUST00000062067 MI0000137 mmu-let-7g UGAGGUAGUAGUUUGUACAGUU
ENSMUST00000062067 MI0000138 mmu-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENSMUST00000062067 MI0000229 mmu-miR-187 UCGUGUCUUGUGUUGCAGCCGG
ENSMUST00000062067 MI0000230 mmu-miR-188-3p CUCCCACAUGCAGGGUUUGCA
ENSMUST00000062067 MI0005485 mmu-miR-197 UUCACCACCUUCUCCACCCAGC
ENSMUST00000062067 MI0000247 mmu-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENSMUST00000062067 MI0000250 mmu-miR-207 GCUUCUCCUGGCUCUCCUCCCUC
ENSMUST00000062067 MI0000708 mmu-miR-211 UUCCCUUUGUCAUCCUUUGCCU
ENSMUST00000062067 MI0000698 mmu-miR-214 ACAGCAGGCACAGACAGGCAGU
ENSMUST00000062067 MI0000700 mmu-miR-218 UUGUGCUUGAUCUAACCAUGU
ENSMUST00000062067 MI0000701 mmu-miR-218 UUGUGCUUGAUCUAACCAUGU
ENSMUST00000062067 MI0000701 mmu-miR-218-2* CAUGGUUCUGUCAAGCACCGCG
ENSMUST00000062067 MI0000231 mmu-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSMUST00000062067 MI0000572 mmu-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSMUST00000062067 MI0000398 mmu-miR-298 GGCAGAGGAGGGCUGUUCUUCCC
ENSMUST00000062067 MI0000609 mmu-miR-331-3p GCCCCUGGGCCUAUCCUAGAA
ENSMUST00000062067 MI0000793 mmu-miR-376a AUCGUAGAGGAAAAUCCACGU
ENSMUST00000062067 MI0001447 mmu-miR-425* AUCGGGAAUGUCGUGUCCGCC
ENSMUST00000062067 MI0003484 mmu-miR-483 AAGACGGGAGAAGAGAAGGGAG
ENSMUST00000062067 MI0005516 mmu-miR-509-5p UACUCCAGAAUGUGGCAAUCAU
ENSMUST00000062067 MI0005554 mmu-miR-511 AUGCCUUUUGCUCUGCACUCA
ENSMUST00000062067 MI0003206 mmu-miR-532-3p CCUCCCACACCCAAGGCUUGCA
ENSMUST00000062067 MI0003522 mmu-miR-542-5p CUCGGGGAUCAUCAUGUCACGA
ENSMUST00000062067 MI0005004 mmu-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC
ENSMUST00000062067 MI0004258 mmu-miR-672 UGAGGUUGGUGUACUGUGUGUGA
ENSMUST00000062067 MI0005003 mmu-miR-676* ACUCUACAACCUUAGGACUUGC
ENSMUST00000062067 MI0004643 mmu-miR-681 CAGCCUCGCUGGCAGGCAGCU
ENSMUST00000062067 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSMUST00000062067 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSMUST00000062067 MI0004675 mmu-miR-695 AGAUUGGGCAUAGGUGACUGAA
ENSMUST00000062067 MI0004686 mmu-miR-702 UGCCCACCCUUUACCCCGCUC
ENSMUST00000062067 MI0004691 mmu-miR-707 CAGUCAUGCCGCUUGCCUACG
ENSMUST00000062067 MI0004678 mmu-miR-720 AUCUCGCUGGGGCCUCCA
ENSMUST00000062067 MI0000586 mmu-miR-98 UGAGGUAGUAAGUUGUAUUGUU
ENSMUST00000062067 MI0000147 mmu-miR-99b* CAAGCUCGUGUCUGUGGGUCCG
ENSMUST00000062067 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  2. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  3. [ + ] Blackshaw S, et al. (2004) "Genomic analysis of mouse retinal development." PLoS Biol. 2(9):E247. PMID:15226823
  4. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  7. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  8. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  9. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
  10. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548