0610037P05Rik | GeneID:66086 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 66086 Official Symbol 0610037P05Rik
Locus N/A Gene Type protein-coding
Synonyms
Full Name RIKEN cDNA 0610037P05 gene
Description RIKEN cDNA 0610037P05 gene
Chromosome 16 B1
Also Known As hypothetical protein LOC66086
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11919

ID Symbol Protein Species
GeneID:66086 0610037P05Rik NP_079621.1 Mus musculus
GeneID:123811 C16orf63 NP_653201.1 Homo sapiens
GeneID:360461 RGD1305823 XP_340738.1 Rattus norvegicus
GeneID:416598 C16orf63 NP_001006170.1 Gallus gallus
GeneID:567944 LOC567944 XP_696350.3 Danio rerio
GeneID:749302 LOC749302 XP_001167510.1 Pan troglodytes
GeneID:782821 LOC782821 XP_001250896.1 Bos taurus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_025345  UCSC Browser NP_079621

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000023357 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENSMUST00000023357 MI0003164 hsa-miR-520d-5p CUACAAAGGGAAGCCCUUUC
ENSMUST00000023357 MI0003595 hsa-miR-587 UUUCCAUAGGUGAUGAGUCAC
ENSMUST00000023357 MI0003657 hsa-miR-642 GUCCCUCUCCAAAUGUGUCUUG
ENSMUST00000023357 MI0005760 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU
ENSMUST00000023357 MI0000556 mmu-let-7a* CUAUACAAUCUACUGUCUUUCC
ENSMUST00000023357 MI0000558 mmu-let-7b* CUAUACAACCUACUGCCUUCCC
ENSMUST00000023357 MI0000587 mmu-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSMUST00000023357 MI0000588 mmu-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSMUST00000023357 MI0000684 mmu-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENSMUST00000023357 MI0000585 mmu-miR-129-3p AAGCCCUUACCCCAAAAAGCAU
ENSMUST00000023357 MI0000165 mmu-miR-140 CAGUGGUUUUACCCUAUGGUAG
ENSMUST00000023357 MI0000175 mmu-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENSMUST00000023357 MI0000564 mmu-miR-15a UAGCAGCACAUAAUGGUUUGUG
ENSMUST00000023357 MI0000237 mmu-miR-195 UAGCAGCACAGAAAUAUUGGC
ENSMUST00000023357 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENSMUST00000023357 MI0000392 mmu-miR-294* ACUCAAAAUGGAGGCCCUAUCU
ENSMUST00000023357 MI0003717 mmu-miR-302c AAGUGCUUCCAUGUUUCAGUGG
ENSMUST00000023357 MI0000590 mmu-miR-322* AAACAUGAAGCGCUGCAACAC
ENSMUST00000023357 MI0003535 mmu-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENSMUST00000023357 MI0003520 mmu-miR-539 GGAGAAAUUAUCCUUGGUGUGU
ENSMUST00000023357 MI0005551 mmu-miR-875-3p CCUGAAAAUACUGAGGCUAUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  2. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  7. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  8. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  9. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636