0610038F07Rik | GeneID:66072 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 66072 Official Symbol 0610038F07Rik
Locus N/A Gene Type protein-coding
Synonyms AA407634; AW049997; MGC61338
Full Name RIKEN cDNA 0610038F07 gene
Description RIKEN cDNA 0610038F07 gene
Chromosome 19 A
Also Known As hypothetical protein LOC66072
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 32370

ID Symbol Protein Species
GeneID:35797 CG14757 NP_610363.1 Drosophila melanogaster
GeneID:36103 CG12895 NP_610586.3 Drosophila melanogaster
GeneID:54949 C11orf79 NP_060311.1 Homo sapiens
GeneID:66072 0610038F07Rik NP_079609.2 Mus musculus
GeneID:361726 RGD1309216 NP_001008372.1 Rattus norvegicus
GeneID:426015 LOC426015 XP_423694.2 Gallus gallus
GeneID:476065 LOC476065 XP_533273.2 Canis lupus familiaris
GeneID:569482 zgc:163000 NP_001076333.1 Danio rerio
GeneID:767983 MGC128747 NP_001070513.1 Bos taurus
GeneID:768441 LOC768441 XP_001231365.1 Gallus gallus
GeneID:854083 EMI5 NP_014570.1 Saccharomyces cerevisiae
GeneID:1268864 ENSANGG00000010992 XP_307436.2 Anopheles gambiae
GeneID:1280494 AgaP_AGAP012191 XP_320341.2 Anopheles gambiae
GeneID:2683048 MGG_07034 XP_367109.1 Magnaporthe grisea
GeneID:2708728 NCU01343.1 XP_326836.1 Neurospora crassa
GeneID:2894506 KLLA0E13343g XP_454550.1 Kluyveromyces lactis
GeneID:4621267 AGOS_AER200C NP_985057.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005739 Component mitochondrion
GO:0003674 Function molecular_function
GO:0008150 Process biological_process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_025333  UCSC Browser NP_079609

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000025570 MI0004999 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENSMUST00000025570 MI0005000 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENSMUST00000025570 MI0003131 hsa-miR-492 AGGACCUGCGGGACAAGAUUCUU
ENSMUST00000025570 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSMUST00000025570 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSMUST00000025570 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENSMUST00000025570 MI0000137 mmu-let-7g* ACUGUACAGGCCACUGCCUUGC
ENSMUST00000025570 MI0000154 mmu-miR-127 UCGGAUCCGUCUGAGCUUGGCU
ENSMUST00000025570 MI0000176 mmu-miR-154* AAUCAUACACGGUUGACCUAUU
ENSMUST00000025570 MI0000231 mmu-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSMUST00000025570 MI0000572 mmu-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSMUST00000025570 MI0000707 mmu-miR-33 GUGCAUUGUAGUUGCAUUGCA
ENSMUST00000025570 MI0004636 mmu-miR-497 CAGCAGCACACUGUGGUUUGUA
ENSMUST00000025570 MI0003206 mmu-miR-532-5p CAUGCCUUGAGUGUAGGACCGU
ENSMUST00000025570 MI0004682 mmu-miR-698 CAUUCUCGUUUCCUUCCCU
ENSMUST00000025570 MI0004683 mmu-miR-699 AGGCAGUGCGACCUGGCUCG
ENSMUST00000025570 MI0004685 mmu-miR-701 UUAGCCGCUGAAAUAGAUGGA
ENSMUST00000025570 MI0000581 mmu-miR-93* ACUGCUGAGCUAGCACUUCCCG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  2. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  3. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  5. [ + ] Wheeler DL, et al. (2001) "Database resources of the National Center for Biotechnology Information." Nucleic Acids Res. 29(1):11-16. PMID:11125038
  6. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  7. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  8. [ + ] Tanaka TS, et al. (2000) "Genome-wide expression profiling of mid-gestation placenta and embryo using a 15,000 mouse developmental cDNA microarray." Proc Natl Acad Sci U S A. 97(16):9127-9132. PMID:10922068
  9. [ + ] Phillips RL, et al. (2000) "The genetic program of hematopoietic stem cells." Science. 288(5471):1635-1640. PMID:10834841
  10. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  11. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
  12. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548