0610009D07Rik | GeneID:66055 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 66055 Official Symbol 0610009D07Rik
Locus N/A Gene Type protein-coding
Synonyms 6030419K15Rik; AV001342; Sf3b14
Full Name RIKEN cDNA 0610009D07 gene
Description RIKEN cDNA 0610009D07 gene
Chromosome 12 A1.1
Also Known As splicing factor 3B, 14 kDa subunit
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 9360

ID Symbol Protein Species
GeneID:38720 CG13298 NP_648037.1 Drosophila melanogaster
GeneID:51639 SF3B14 NP_057131.1 Homo sapiens
GeneID:66055 0610009D07Rik NP_079599.1 Mus musculus
GeneID:173394 C50D2.5 NP_493659.3 Caenorhabditis elegans
GeneID:415157 sf3b14 NP_001002067.1 Danio rerio
GeneID:421976 SF3B14 XP_419986.1 Gallus gallus
GeneID:459061 LOC459061 XP_515324.1 Pan troglodytes
GeneID:475682 LOC475682 XP_532889.1 Canis lupus familiaris
GeneID:508876 SF3B14 NP_001039482.1 Bos taurus
GeneID:811292 PFL1200c XP_001350646.1 Plasmodium falciparum
GeneID:831092 AT5G12190 NP_196780.1 Arabidopsis thaliana
GeneID:1273189 AgaP_AGAP002780 XP_312143.2 Anopheles gambiae
GeneID:4334543 Os03g0811700 NP_001051674.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005634 Component nucleus
GO:0003676 Function nucleic acid binding
GO:0000166 Function nucleotide binding
GO:0003723 Function RNA binding
GO:0006397 Process mRNA processing
GO:0008380 Process RNA splicing

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_025323  UCSC Browser NP_079599

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000046207 MI0004999 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENSMUST00000046207 MI0005000 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENSMUST00000046207 MI0003180 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSMUST00000046207 MI0003181 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSMUST00000046207 MI0003169 hsa-miR-518e AAAGCGCUUCCCUUCAGAGUG
ENSMUST00000046207 MI0003557 hsa-miR-552 AACAGGUGACUGGUUAGACAA
ENSMUST00000046207 MI0003583 hsa-miR-576-5p AUUCUAAUUUCUCCACGUCUUU
ENSMUST00000046207 MI0003586 hsa-miR-579 UUCAUUUGGUAUAAACCGCGAUU
ENSMUST00000046207 MI0003613 hsa-miR-600 ACUUACAGACAAGAGCCUUGCUC
ENSMUST00000046207 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENSMUST00000046207 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENSMUST00000046207 MI0000153 mmu-miR-126-5p CAUUAUUACUUUUGGUACGCG
ENSMUST00000046207 MI0000172 mmu-miR-150* CUGGUACAGGCCUGGGGGAUAG
ENSMUST00000046207 MI0000177 mmu-miR-155 UUAAUGCUAAUUGUGAUAGGGGU
ENSMUST00000046207 MI0000140 mmu-miR-15b UAGCAGCACAUCAUGGUUUACA
ENSMUST00000046207 MI0000223 mmu-miR-181a-2* ACCGACCGUUGACUGUACCUUG
ENSMUST00000046207 MI0000553 mmu-miR-196a* UCGGCAACAAGAAACUGCCUGA
ENSMUST00000046207 MI0000569 mmu-miR-21 UAGCUUAUCAGACUGAUGUUGA
ENSMUST00000046207 MI0000690 mmu-miR-28 AAGGAGCUCACAGUCUAUUGAG
ENSMUST00000046207 MI0000393 mmu-miR-295* ACUCAAAUGUGGGGCACACUUC
ENSMUST00000046207 MI0003717 mmu-miR-302c* GCUUUAACAUGGGGUUACCUGC
ENSMUST00000046207 MI0000619 mmu-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG
ENSMUST00000046207 MI0000619 mmu-miR-338-5p AACAAUAUCCUGGUGCUGAGUG
ENSMUST00000046207 MI0001524 mmu-miR-431 UGUCUUGCAGGCCGUCAUGCA
ENSMUST00000046207 MI0001525 mmu-miR-433 AUCAUGAUGGGCUCCUCGGUGU
ENSMUST00000046207 MI0004679 mmu-miR-455 GCAGUCCACGGGCAUAUACAC
ENSMUST00000046207 MI0003491 mmu-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENSMUST00000046207 MI0005555 mmu-miR-544 AUUCUGCAUUUUUAGCAAGCUC
ENSMUST00000046207 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENSMUST00000046207 MI0005519 mmu-miR-590-5p GAGCUUAUUCAUAAAAGUGCAG
ENSMUST00000046207 MI0004965 mmu-miR-652 AAUGGCGCCACUAGGGUUGUG
ENSMUST00000046207 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENSMUST00000046207 MI0004123 mmu-miR-675-5p UGGUGCGGAAAGGGCCCACAGU
ENSMUST00000046207 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENSMUST00000046207 MI0005549 mmu-miR-872 AAGGUUACUUGUUAGUUCAGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  2. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  3. [ + ] McKee AE, et al. (2005) "A genome-wide in situ hybridization map of RNA-binding proteins reveals anatomically restricted expression in the developing mouse brain." BMC Dev Biol. 5():14. PMID:16033648
  4. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  5. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  6. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  7. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  8. [ + ] Tanaka TS, et al. (2000) "Genome-wide expression profiling of mid-gestation placenta and embryo using a 15,000 mouse developmental cDNA microarray." Proc Natl Acad Sci U S A. 97(16):9127-9132. PMID:10922068
  9. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  10. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  11. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636