0610009B22Rik | GeneID:66050 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 66050 Official Symbol 0610009B22Rik
Locus RP23-79E13.7 Gene Type protein-coding
Synonyms
Full Name RIKEN cDNA 0610009B22 gene
Description RIKEN cDNA 0610009B22 gene
Chromosome 11 B1.3
Also Known As OTTMUSP00000005776; OTTMUSP00000005777; hypothetical protein LOC66050
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_025319  UCSC Browser NP_079595 Q8R3W2   Q9CQP2  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000007921 MI0003557 hsa-miR-552 AACAGGUGACUGGUUAGACAA
ENSMUST00000007921 MI0003561 hsa-miR-555 AGGGUAAGCUGAACCUCUGAU
ENSMUST00000007921 MI0003562 hsa-miR-556-5p GAUGAGCUCAUUGUAAUAUGAG
ENSMUST00000007921 MI0003584 hsa-miR-577 UAGAUAAAAUAUUGGUACCUG
ENSMUST00000007921 MI0003619 hsa-miR-606 AAACUACUGAAAAUCAAAGAU
ENSMUST00000007921 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENSMUST00000007921 MI0003660 hsa-miR-645 UCUAGGCUGGUACUGCUGA
ENSMUST00000007921 MI0005527 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU
ENSMUST00000007921 MI0005756 hsa-miR-934 UGUCUACUACUGGAGACACUGG
ENSMUST00000007921 MI0000148 mmu-miR-101a UACAGUACUGUGAUAACUGAA
ENSMUST00000007921 MI0000649 mmu-miR-101b UACAGUACUGUGAUAGCUGAA
ENSMUST00000007921 MI0000150 mmu-miR-124* CGUGUUCACAGCGGACCUUGAU
ENSMUST00000007921 MI0000716 mmu-miR-124* CGUGUUCACAGCGGACCUUGAU
ENSMUST00000007921 MI0000717 mmu-miR-124* CGUGUUCACAGCGGACCUUGAU
ENSMUST00000007921 MI0000151 mmu-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC
ENSMUST00000007921 MI0000722 mmu-miR-138* CGGCUACUUCACAACACCAGGG
ENSMUST00000007921 MI0000697 mmu-miR-181a-1* ACCAUCGACCGUUGAUUGUACC
ENSMUST00000007921 MI0000723 mmu-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSMUST00000007921 MI0000823 mmu-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSMUST00000007921 MI0005450 mmu-miR-181d AACAUUCAUUGUUGUCGGUGGGU
ENSMUST00000007921 MI0000573 mmu-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSMUST00000007921 MI0000706 mmu-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSMUST00000007921 MI0000575 mmu-miR-26b UUCAAGUAAUUCAGGAUAGGU
ENSMUST00000007921 MI0000578 mmu-miR-27a* AGGGCUUAGCUGCUUGUGAGCA
ENSMUST00000007921 MI0000590 mmu-miR-322* AAACAUGAAGCGCUGCAACAC
ENSMUST00000007921 MI0000595 mmu-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
ENSMUST00000007921 MI0000597 mmu-miR-325 UUUAUUGAGCACCUCCUAUCAA
ENSMUST00000007921 MI0000597 mmu-miR-325* CCUAGUAGGUGCUCAGUAAGUGU
ENSMUST00000007921 MI0000605 mmu-miR-329 AACACACCCAGCUAACCUUUUU
ENSMUST00000007921 MI0000619 mmu-miR-338-5p AACAAUAUCCUGGUGCUGAGUG
ENSMUST00000007921 MI0004125 mmu-miR-374 AUAUAAUACAACCUGCUAAGUG
ENSMUST00000007921 MI0003533 mmu-miR-376c AACAUAGAGGAAAUUUCACGU
ENSMUST00000007921 MI0000800 mmu-miR-383 AGAUCAGAAGGUGACUGUGGCU
ENSMUST00000007921 MI0001525 mmu-miR-433 AUCAUGAUGGGCUCCUCGGUGU
ENSMUST00000007921 MI0001653 mmu-miR-450a-5p UUUUGCGAUGUGUUCCUAAUAU
ENSMUST00000007921 MI0003537 mmu-miR-450a-5p UUUUGCGAUGUGUUCCUAAUAU
ENSMUST00000007921 MI0004705 mmu-miR-450b-5p UUUUGCAGUAUGUUCCUGAAUA
ENSMUST00000007921 MI0003520 mmu-miR-539 GGAGAAAUUAUCCUUGGUGUGU
ENSMUST00000007921 MI0005555 mmu-miR-544 AUUCUGCAUUUUUAGCAAGCUC
ENSMUST00000007921 MI0006127 mmu-miR-582-3p CCUGUUGAACAACUGAACCCAA
ENSMUST00000007921 MI0005519 mmu-miR-590-3p UAAUUUUAUGUAUAAGCUAGU
ENSMUST00000007921 MI0005520 mmu-miR-654-5p UGGUAAGCUGCAGAACAUGUGU
ENSMUST00000007921 MI0004673 mmu-miR-669c AUAGUUGUGUGUGGAUGUGUGU
ENSMUST00000007921 MI0004653 mmu-miR-688 UCGCAGGCGACUACUUAUUC
ENSMUST00000007921 MI0005205 mmu-miR-741 UGAGAGAUGCCAUUCUAUGUAGA
ENSMUST00000007921 MI0005204 mmu-miR-805 GAAUUGAUCAGGACAUAGGG
ENSMUST00000007921 MI0005549 mmu-miR-872 AAGGUUACUUGUUAGUUCAGG
ENSMUST00000007921 MI0005551 mmu-miR-875-5p UAUACCUCAGUUUUAUCAGGUG
ENSMUST00000007921 MI0005480 mmu-miR-876-3p UAGUGGUUUACAAAGUAAUUCA
ENSMUST00000007921 MI0005472 mmu-miR-879 AGAGGCUUAUAGCUCUAAGCC
ENSMUST00000007921 MI0005476 mmu-miR-883a-5p UGCUGAGAGAAGUAGCAGUUAC
ENSMUST00000007921 MI0000581 mmu-miR-93* ACUGCUGAGCUAGCACUUCCCG
ENSMUST00000007921 MI0000644 rno-miR-352 AGAGUAGUAGGUUGCAUAGUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  2. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  3. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  5. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  6. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  7. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  8. [ + ] Tanaka TS, et al. (2000) "Genome-wide expression profiling of mid-gestation placenta and embryo using a 15,000 mouse developmental cDNA microarray." Proc Natl Acad Sci U S A. 97(16):9127-9132. PMID:10922068
  9. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
  10. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548