AACS | GeneID:65985 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 65985 Official Symbol AACS
Locus N/A Gene Type protein-coding
Synonyms ACSF1; FLJ12389; FLJ41251; SUR-5
Full Name acetoacetyl-CoA synthetase
Description acetoacetyl-CoA synthetase
Chromosome 12q24.31
Also Known As acetoacetate-CoA ligase; acyl-CoA synthetase family member 1; homolog of C. elegans supressor of ras 5 (sur-5)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11322

ID Symbol Protein Species
GeneID:65984 Aacs NP_075592.1 Rattus norvegicus
GeneID:65985 AACS NP_076417.2 Homo sapiens
GeneID:78894 Aacs NP_084486.1 Mus musculus
GeneID:180992 sur-5 NP_509229.1 Caenorhabditis elegans
GeneID:393984 aacs NP_957303.1 Danio rerio
GeneID:416811 AACS NP_001006184.1 Gallus gallus
GeneID:452361 AACS XP_001135709.1 Pan troglodytes
GeneID:486240 AACS XP_543365.2 Canis lupus familiaris
GeneID:505842 AACS XP_582199.3 Bos taurus
GeneID:2675470 MGG_05196 XP_359581.2 Magnaporthe grisea
GeneID:2704372 NCU00446.1 XP_322532.1 Neurospora crassa

Exon, Intron and UTRs

Exon, Intron and UTRs of AACS Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of AACS Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005829 Component cytosol
GO:0030729 Function acetoacetate-CoA ligase activity
GO:0005524 Function ATP binding
GO:0016874 Function ligase activity
GO:0000166 Function nucleotide binding
GO:0006631 Process fatty acid metabolic process
GO:0006629 Process lipid metabolic process
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_023928  UCSC Browser NP_076417

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000316519 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENST00000316519 MI0000472 hsa-miR-127-5p CUGAAGCUCAGAGGGCUCUGAU
ENST00000316519 MI0000261 hsa-miR-139-5p UCUACAGUGCACGUGUCUCCAG
ENST00000316519 MI0000073 hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENST00000316519 MI0000074 hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENST00000316519 MI0000075 hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENST00000316519 MI0000301 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU
ENST00000316519 MI0000439 hsa-miR-23b AUCACAUUGCCAGGGAUUACC
ENST00000316519 MI0000105 hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENST00000316519 MI0000107 hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENST00000316519 MI0005525 hsa-miR-300 UAUACAAGGGCAGACUCUCUCU
ENST00000316519 MI0000089 hsa-miR-31 AGGCAAGAUGCUGGCAUAGCU
ENST00000316519 MI0000091 hsa-miR-33a GUGCAUUGUAGUUGCAUUGCA
ENST00000316519 MI0000805 hsa-miR-342-5p AGGGGUGCUAUCUGUGAUUGA
ENST00000316519 MI0000784 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENST00000316519 MI0003529 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENST00000316519 MI0002466 hsa-miR-376b AUCAUAGAGGAAAAUCCAUGUU
ENST00000316519 MI0001448 hsa-miR-425 AAUGACACGAUCACUCCCGUUGA
ENST00000316519 MI0003194 hsa-miR-507 UUUUGCACCUUUUGGAGUGAA
ENST00000316519 MI0003167 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENST00000316519 MI0003172 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENST00000316519 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENST00000316519 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENST00000316519 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENST00000316519 MI0003582 hsa-miR-575 GAGCCAGUUGGACAGGAGC
ENST00000316519 MI0003615 hsa-miR-602 GACACGGGCGACAGCUGCGGCCC
ENST00000316519 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENST00000316519 MI0005527 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU
ENST00000316519 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENST00000316519 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000316519 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000316519 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000316519 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENST00000316519 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENST00000316519 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENST00000316519 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENST00000316519 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENST00000316519 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENST00000316519 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of AACS mRNA
17562736
Dietary Fats
  • Dietary Fats results in decreased expression of AACS mRNA
18042831
palm oil
  • palm oil results in decreased expression of AACS mRNA
18042831
Phthalic Acids
  • Phthalic Acids results in decreased expression of AACS mRNA
15728792
pirinixic acid
  • pirinixic acid results in increased expression of AACS mRNA
18301758
Testosterone
  • Testosterone results in increased expression of AACS mRNA
16579987
Tetrachlorodibenzodioxin
  • Tetrachlorodibenzodioxin results in decreased expression of AACS mRNA
18295293

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Adenoma, Liver Cell inferred via Tetrachlorodibenzodioxin 16835633
Carcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cholangiocarcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cleft Palate inferred via Tetrachlorodibenzodioxin 8697196
Diabetes Mellitus, Type 2 inferred via Tetrachlorodibenzodioxin 17107852
Hydronephrosis inferred via Tetrachlorodibenzodioxin 8697196
Liver Neoplasms inferred via Tetrachlorodibenzodioxin 16984957
Antisocial Personality Disorder inferred via Testosterone 7506515
Breast Neoplasms inferred via Testosterone 17261762
Firesetting Behavior inferred via Testosterone 7506515
Glioblastoma inferred via Testosterone 17162496
Hirsutism inferred via Testosterone 17019078
Hyperandrogenism inferred via Testosterone 17019078
Hypopituitarism inferred via Testosterone 17426086
Impulse Control Disorders inferred via Testosterone 7506515
Sexual Dysfunction, Physiological inferred via Testosterone 16631401
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 14986274, 16227642, 15968718, 16177239, 17562736, 17522070
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489
  2. [ + ] Watkins PA, et al. (2007) "Evidence for 26 distinct acyl-coenzyme A synthetase genes in the human genome." J Lipid Res. 48(12):2736-2750. PMID:17762044
  3. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  4. [ + ] Ohgami M, et al. (2003) "Expression of acetoacetyl-CoA synthetase, a novel cytosolic ketone body-utilizing enzyme, in human brain." Biochem Pharmacol. 65(6):989-994. PMID:12623130
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Gu T, et al. (1998) "Caenorhabditis elegans SUR-5, a novel but conserved protein, negatively regulates LET-60 Ras activity during vulval induction." Mol Cell Biol. 18(8):4556-4564. PMID:9671465
  7. [ + ] Bergstrom JD, et al. (1985) "A radiochemical assay for acetoacetyl-CoA synthetase." Anal Biochem. 149(2):358-364. PMID:4073493