AACS | GeneID:65985 | Homo sapiens
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 65985 | Official Symbol | AACS |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | ACSF1; FLJ12389; FLJ41251; SUR-5 | ||
| Full Name | acetoacetyl-CoA synthetase | ||
| Description | acetoacetyl-CoA synthetase | ||
| Chromosome | 12q24.31 | ||
| Also Known As | acetoacetate-CoA ligase; acyl-CoA synthetase family member 1; homolog of C. elegans supressor of ras 5 (sur-5) | ||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 11322
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:65984 | Aacs | NP_075592.1 | Rattus norvegicus |
| GeneID:65985 | AACS | NP_076417.2 | Homo sapiens |
| GeneID:78894 | Aacs | NP_084486.1 | Mus musculus |
| GeneID:180992 | sur-5 | NP_509229.1 | Caenorhabditis elegans |
| GeneID:393984 | aacs | NP_957303.1 | Danio rerio |
| GeneID:416811 | AACS | NP_001006184.1 | Gallus gallus |
| GeneID:452361 | AACS | XP_001135709.1 | Pan troglodytes |
| GeneID:486240 | AACS | XP_543365.2 | Canis lupus familiaris |
| GeneID:505842 | AACS | XP_582199.3 | Bos taurus |
| GeneID:2675470 | MGG_05196 | XP_359581.2 | Magnaporthe grisea |
| GeneID:2704372 | NCU00446.1 | XP_322532.1 | Neurospora crassa |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005737 | Component | cytoplasm |
| GO:0005829 | Component | cytosol |
| GO:0030729 | Function | acetoacetate-CoA ligase activity |
| GO:0005524 | Function | ATP binding |
| GO:0016874 | Function | ligase activity |
| GO:0000166 | Function | nucleotide binding |
| GO:0006631 | Process | fatty acid metabolic process |
| GO:0006629 | Process | lipid metabolic process |
| GO:0008152 | Process | metabolic process |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENST00000316519 | MI0004998 | gga-miR-460 | CCUGCAUUGUACACACUGUGUG |
| ENST00000316519 | MI0000472 | hsa-miR-127-5p | CUGAAGCUCAGAGGGCUCUGAU |
| ENST00000316519 | MI0000261 | hsa-miR-139-5p | UCUACAGUGCACGUGUCUCCAG |
| ENST00000316519 | MI0000073 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
| ENST00000316519 | MI0000074 | hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA |
| ENST00000316519 | MI0000075 | hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA |
| ENST00000316519 | MI0000301 | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUU |
| ENST00000316519 | MI0000439 | hsa-miR-23b | AUCACAUUGCCAGGGAUUACC |
| ENST00000316519 | MI0000105 | hsa-miR-29b | UAGCACCAUUUGAAAUCAGUGUU |
| ENST00000316519 | MI0000107 | hsa-miR-29b | UAGCACCAUUUGAAAUCAGUGUU |
| ENST00000316519 | MI0005525 | hsa-miR-300 | UAUACAAGGGCAGACUCUCUCU |
| ENST00000316519 | MI0000089 | hsa-miR-31 | AGGCAAGAUGCUGGCAUAGCU |
| ENST00000316519 | MI0000091 | hsa-miR-33a | GUGCAUUGUAGUUGCAUUGCA |
| ENST00000316519 | MI0000805 | hsa-miR-342-5p | AGGGGUGCUAUCUGUGAUUGA |
| ENST00000316519 | MI0000784 | hsa-miR-376a | AUCAUAGAGGAAAAUCCACGU |
| ENST00000316519 | MI0003529 | hsa-miR-376a | AUCAUAGAGGAAAAUCCACGU |
| ENST00000316519 | MI0002466 | hsa-miR-376b | AUCAUAGAGGAAAAUCCAUGUU |
| ENST00000316519 | MI0001448 | hsa-miR-425 | AAUGACACGAUCACUCCCGUUGA |
| ENST00000316519 | MI0003194 | hsa-miR-507 | UUUUGCACCUUUUGGAGUGAA |
| ENST00000316519 | MI0003167 | hsa-miR-516b | AUCUGGAGGUAAGAAGCACUUU |
| ENST00000316519 | MI0003172 | hsa-miR-516b | AUCUGGAGGUAAGAAGCACUUU |
| ENST00000316519 | MI0003170 | hsa-miR-518a-5p | CUGCAAAGGGAAGCCCUUUC |
| ENST00000316519 | MI0003173 | hsa-miR-518a-5p | CUGCAAAGGGAAGCCCUUUC |
| ENST00000316519 | MI0003596 | hsa-miR-548b-3p | CAAGAACCUCAGUUGCUUUUGU |
| ENST00000316519 | MI0003582 | hsa-miR-575 | GAGCCAGUUGGACAGGAGC |
| ENST00000316519 | MI0003615 | hsa-miR-602 | GACACGGGCGACAGCUGCGGCCC |
| ENST00000316519 | MI0003616 | hsa-miR-603 | CACACACUGCAAUUACUUUUGC |
| ENST00000316519 | MI0005527 | hsa-miR-886-3p | CGCGGGUGCUUACUGACCCUU |
| ENST00000316519 | MI0002401 | mmu-miR-466a-5p | UAUGUGUGUGUACAUGUACAUA |
| ENST00000316519 | MI0005502 | mmu-miR-466b-5p | GAUGUGUGUGUACAUGUACAUG |
| ENST00000316519 | MI0005503 | mmu-miR-466b-5p | GAUGUGUGUGUACAUGUACAUG |
| ENST00000316519 | MI0005504 | mmu-miR-466b-5p | GAUGUGUGUGUACAUGUACAUG |
| ENST00000316519 | MI0005505 | mmu-miR-466c-5p | GAUGUGUGUGUGCAUGUACAUA |
| ENST00000316519 | MI0005546 | mmu-miR-466d-5p | UGUGUGUGCGUACAUGUACAUG |
| ENST00000316519 | MI0005506 | mmu-miR-466e-5p | GAUGUGUGUGUACAUGUACAUA |
| ENST00000316519 | MI0005510 | mmu-miR-466g | AUACAGACACAUGCACACACA |
| ENST00000316519 | MI0005512 | mmu-miR-467c | UAAGUGCGUGCAUGUAUAUGUG |
| ENST00000316519 | MI0005513 | mmu-miR-467d | UAAGUGCGCGCAUGUAUAUGCG |
| ENST00000316519 | MI0005548 | mmu-miR-878-3p | GCAUGACACCACACUGGGUAGA |
Chemicals and Drugs
[
] Comparative Toxicogenomics Database from MDI Biological Lab
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Chemical and Interaction | |
|---|---|
| Acetaminophen | |
|
|
| Dietary Fats | |
|
|
| palm oil | |
|
|
| Phthalic Acids | |
|
|
| pirinixic acid | |
|
|
| Testosterone | |
|
|
| Tetrachlorodibenzodioxin | |
|
|
Gene and Diseases
[
] Gene and Diseases [Data source: CTD]
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Disease Name | Relationship | PubMed |
|---|---|---|
| Adenoma, Liver Cell | inferred via Tetrachlorodibenzodioxin | 16835633 |
| Carcinoma | inferred via Tetrachlorodibenzodioxin | 16835633 |
| Cholangiocarcinoma | inferred via Tetrachlorodibenzodioxin | 16835633 |
| Cleft Palate | inferred via Tetrachlorodibenzodioxin | 8697196 |
| Diabetes Mellitus, Type 2 | inferred via Tetrachlorodibenzodioxin | 17107852 |
| Hydronephrosis | inferred via Tetrachlorodibenzodioxin | 8697196 |
| Liver Neoplasms | inferred via Tetrachlorodibenzodioxin | 16984957 |
| Antisocial Personality Disorder | inferred via Testosterone | 7506515 |
| Breast Neoplasms | inferred via Testosterone | 17261762 |
| Firesetting Behavior | inferred via Testosterone | 7506515 |
| Glioblastoma | inferred via Testosterone | 17162496 |
| Hirsutism | inferred via Testosterone | 17019078 |
| Hyperandrogenism | inferred via Testosterone | 17019078 |
| Hypopituitarism | inferred via Testosterone | 17426086 |
| Impulse Control Disorders | inferred via Testosterone | 7506515 |
| Sexual Dysfunction, Physiological | inferred via Testosterone | 16631401 |
| Edema | inferred via pirinixic acid | 12083418 |
| Liver Neoplasms | inferred via pirinixic acid | 15890375 |
| Arteriosclerosis | inferred via Dietary Fats | 15238619 |
| Dyslipidemias | inferred via Dietary Fats | 18367378 |
| Insulin Resistance | inferred via Dietary Fats | 18457598 |
| Obesity | inferred via Dietary Fats | 18457598, 17217161 |
| Hepatitis, Toxic | inferred via Acetaminophen | 2444490, 16081117, 14986274, 16227642, 15968718, 16177239, 17562736, 17522070 |
| Hyperalgesia | inferred via Acetaminophen | 16870215 |
| Liver Failure, Acute | inferred via Acetaminophen | 16871587, 17185352 |
| Pain | inferred via Acetaminophen | 16870215 |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489 - [
] Watkins PA, et al. (2007) "Evidence for 26 distinct acyl-coenzyme A synthetase genes in the human genome." J Lipid Res. 48(12):2736-2750. PMID:17762044 - [
] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039 - [
] Ohgami M, et al. (2003) "Expression of acetoacetyl-CoA synthetase, a novel cytosolic ketone body-utilizing enzyme, in human brain." Biochem Pharmacol. 65(6):989-994. PMID:12623130 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Gu T, et al. (1998) "Caenorhabditis elegans SUR-5, a novel but conserved protein, negatively regulates LET-60 Ras activity during vulval induction." Mol Cell Biol. 18(8):4556-4564. PMID:9671465 - [
] Bergstrom JD, et al. (1985) "A radiochemical assay for acetoacetyl-CoA synthetase." Anal Biochem. 149(2):358-364. PMID:4073493
The known genetic variants determining plasma HDL cholesterol (HDL-C) levels explain only part of its variation. Three hundred eighty-four single nucleotide polymorphisms (SNPs) across 251 genes based on pathways potentially relevant to HDL-C metabolism were selected and genotyped in 3,575 subjects from the Doetinchem cohort, which was examined thrice over 11 years. Three hundred fifty-three SNPs in 239 genes passed the quality-control criteria. Seven SNPs [rs1800777 and rs5882 in cholesteryl ester transfer protein (CETP); rs3208305, rs328, and rs268 in LPL; rs1800588 in LIPC; rs2229741 in NRIP1] were associated with plasma HDL-C levels with false discovery rate (FDR) adjusted q values (FDR_q) < 0.05. Five other SNPs (rs17585739 in SC4MOL, rs11066322 in PTPN11, rs4961 in ADD1, rs6060717 near SCAND1, and rs3213451 in MBTPS2 in women) were associated with plasma HDL-C levels with FDR_q between 0.05 and 0.2. Two less well replicated associations (rs3135506 in APOA5 and rs1800961 in HNF4A) known from the literature were also observed, but their significance disappeared after adjustment for multiple testing (P = 0.008, FDR_q = 0.221 for rs3135506; P = 0.018, FDR_q = 0.338 for rs1800961, respectively). In addition to replication of previous results for candidate genes (CETP, LPL, LIPC, HNF4A, and APOA5), we found interesting new candidate SNPs (rs2229741 in NRIP1, rs3213451 in MBTPS2, rs17585739 in SC4MOL, rs11066322 in PTPN11, rs4961 in ADD1, and rs6060717 near SCAND1) for plasma HDL-C levels that should be evaluated further.
Acyl-coenzyme A synthetases (ACSs) catalyze the fundamental, initial reaction in fatty acid metabolism. "Activation" of fatty acids by thioesterification to CoA allows their participation in both anabolic and catabolic pathways. The availability of the sequenced human genome has facilitated the investigation of the number of ACS genes present. Using two conserved amino acid sequence motifs to probe human DNA databases, 26 ACS family genes/proteins were identified. ACS activity in either humans or rodents was demonstrated previously for 20 proteins, but 6 remain candidate ACSs. For two candidates, cDNA was cloned, protein was expressed in COS-1 cells, and ACS activity was detected. Amino acid sequence similarities were used to assign enzymes into subfamilies, and subfamily assignments were consistent with acyl chain length preference. Four of the 26 proteins did not fit into a subfamily, and bootstrap analysis of phylograms was consistent with evolutionary divergence. Three additional conserved amino acid sequence motifs were identified that likely have functional or structural roles. The existence of many ACSs suggests that each plays a unique role, directing the acyl-CoA product to a specific metabolic fate. Knowing the full complement of ACS genes in the human genome will facilitate future studies to characterize their specific biological functions.
As a base for human transcriptome and functional genomics, we created the "full-length long Japan" (FLJ) collection of sequenced human cDNAs. We determined the entire sequence of 21,243 selected clones and found that 14,490 cDNAs (10,897 clusters) were unique to the FLJ collection. About half of them (5,416) seemed to be protein-coding. Of those, 1,999 clusters had not been predicted by computational methods. The distribution of GC content of nonpredicted cDNAs had a peak at approximately 58% compared with a peak at approximately 42%for predicted cDNAs. Thus, there seems to be a slight bias against GC-rich transcripts in current gene prediction procedures. The rest of the cDNAs unique to the FLJ collection (5,481) contained no obvious open reading frames (ORFs) and thus are candidate noncoding RNAs. About one-fourth of them (1,378) showed a clear pattern of splicing. The distribution of GC content of noncoding cDNAs was narrow and had a peak at approximately 42%, relatively low compared with that of protein-coding cDNAs.
Acetoacetyl-CoA synthetase (AACS, acetoacetate-CoA ligase, EC 6.2.1.16) is a ketone body-utilizing enzyme, the physiological role of which remains unclear yet in mammals, particularly has never been studied in human. In order to investigate the tissue distribution of AACS in human, cDNA encoding AACS was isolated from HepG2 cells. Amino acid sequence of human AACS deduced from the open reading frame showed high homology (89.3%) with that of rat AACS and much less homology (43.7%) with that of bacterial AACS. The expression level of the AACS mRNA was high in kidney, heart and brain, but low in liver, and the expression profile of AACS in the human brain was quite similar to that of 3-hydroxy-3-methylglutaryl-CoA reductase.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
The let-60 ras gene acts in a signal transduction pathway to control vulval differentiation in Caenorhabditis elegans. By screening suppressors of a dominant negative let-60 ras allele, we isolated three loss-of-function mutations in the sur-5 gene which appear to act as negative regulators of let-60 ras during vulval induction. sur-5 mutations do not cause an obvious mutant phenotype of their own, and they appear to specifically suppress only one of the two groups of let-60 ras dominant negative mutations, suggesting that the gene may be involved in a specific aspect of Ras activation. Consistent with its negative function, overexpressing sur-5 from an extragenic array partially suppresses the Multivulva phenotype of an activated let-60 ras mutation and causes synergistic phenotypes with a lin-45 raf mutation. We have cloned sur-5 and shown that it encodes a novel protein. We have also identified a potential mammalian SUR-5 homolog that is about 35% identical to the worm protein. SUR-5 also has some sequence similarity to acetyl coenzyme A synthetases and is predicted to contain ATP/GTP and AMP binding sites. Our results suggest that sur-5 gene function may be conserved through evolution.
A sensitive radiochemical assay is described for the assay of acetoacetyl-CoA synthetase activity in cytosolic extracts. Enzyme activity is measured by the incorporation of 14C from acetoacetate into acetyl carnitine as mediated by acetoacetyl-CoA synthetase, endogenous acetoacetyl-CoA thiolase, and exogenous carnitine acetyl transferase. Separation of 14C-labeled reactants from 14C-labeled acetyl carnitine is achieved by cation-exchange chromatography. The assay is sensitive with less than 10 pmol of product readily detected. Acetoacetyl-CoA synthetase activity was measured in human fibroblasts, 0.12 nmol min-1 mg cytosolic protein-1, and was found to be more than two orders of magnitude below the activity level of acetoacetyl-CoA synthetase in rat liver cytosol, 18.4 nmol min-1 mg cytosolic protein-1. An HPLC method is also described for the purification of [3-14C]acetoacetate.

