Aacs | GeneID:65984 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 65984 Official Symbol Aacs
Locus N/A Gene Type protein-coding
Synonyms
Full Name acetoacetyl-CoA synthetase
Description acetoacetyl-CoA synthetase
Chromosome 12q14
Also Known As
Summary activates acetoacetate to its CoA ester [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11322

ID Symbol Protein Species
GeneID:65984 Aacs NP_075592.1 Rattus norvegicus
GeneID:65985 AACS NP_076417.2 Homo sapiens
GeneID:78894 Aacs NP_084486.1 Mus musculus
GeneID:180992 sur-5 NP_509229.1 Caenorhabditis elegans
GeneID:393984 aacs NP_957303.1 Danio rerio
GeneID:416811 AACS NP_001006184.1 Gallus gallus
GeneID:452361 AACS XP_001135709.1 Pan troglodytes
GeneID:486240 AACS XP_543365.2 Canis lupus familiaris
GeneID:505842 AACS XP_582199.3 Bos taurus
GeneID:2675470 MGG_05196 XP_359581.2 Magnaporthe grisea
GeneID:2704372 NCU00446.1 XP_322532.1 Neurospora crassa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005829 Component cytosol
GO:0030729 Function acetoacetate-CoA ligase activity
GO:0005524 Function ATP binding
GO:0016874 Function ligase activity
GO:0000166 Function nucleotide binding
GO:0006631 Process fatty acid metabolic process
GO:0006629 Process lipid metabolic process
GO:0001889 Process liver development
GO:0008152 Process metabolic process
GO:0032024 Process positive regulation of insulin secretion
GO:0042493 Process response to drug
GO:0045471 Process response to ethanol
GO:0007584 Process response to nutrient
GO:0034201 Process response to oleic acid
GO:0014070 Process response to organic cyclic substance
GO:0010243 Process response to organic nitrogen
GO:0050872 Process white fat cell differentiation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_023104  UCSC Browser NP_075592

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000001292 MI0005468 bta-miR-660 UACCCAUUGCAUAUCGGAGCUG
ENSRNOT00000001292 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSRNOT00000001292 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSRNOT00000001292 MI0003180 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSRNOT00000001292 MI0003181 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSRNOT00000001292 MI0003607 hsa-miR-595 GAAGUGUGCCGUGGUGUGUCU
ENSRNOT00000001292 MI0003642 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA
ENSRNOT00000001292 MI0003642 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG
ENSRNOT00000001292 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENSRNOT00000001292 MI0003669 hsa-miR-661 UGCCUGGGUCUCUGGCCUGCGCGU
ENSRNOT00000001292 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENSRNOT00000001292 MI0004681 mmu-miR-697 AACAUCCUGGUCCUGUGGAGA
ENSRNOT00000001292 MI0000844 rno-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENSRNOT00000001292 MI0000928 rno-miR-183 UAUGGCACUGGUAGAAUUCACU
ENSRNOT00000001292 MI0000863 rno-miR-29a UAGCACCAUCUGAAAUCGGUUA
ENSRNOT00000001292 MI0000865 rno-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENSRNOT00000001292 MI0000631 rno-miR-345-5p UGCUGACCCCUAGUCCAGUGC
ENSRNOT00000001292 MI0000837 rno-miR-7b UGGAAGACUUGUGAUUUUGUUGU
ENSRNOT00000001292 MI0006118 rno-miR-874 CUGCCCUGGCCCGAGGGACCGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Narishima R, et al. (2009) "Genetic obesity affects neural ketone body utilization in the rat brain." Obesity (Silver Spring). 17(3):611-615. PMID:19219059
  2. [ + ] MacDonald MJ, et al. (2007) "Feasibility of pathways for transfer of acyl groups from mitochondria to the cytosol to form short chain acyl-CoAs in the pancreatic beta cell." J Biol Chem. 282(42):30596-30606. PMID:17724028
  3. [ + ] Yamasaki M, et al. (2005) "Acetoacetyl-CoA synthetase gene is abundant in rat adipose, and related with fatty acid synthesis in mature adipocytes." Biochem Biophys Res Commun. 335(1):215-219. PMID:16055091
  4. [ + ] Sato H, et al. (2002) "Effects of streptozotocin-induced diabetes on acetoacetyl-CoA synthetase activity in rats." Biochem Pharmacol. 63(10):1851-1855. PMID:12034369
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Iwahori A, et al. (2000) "cDNA-derived amino acid sequence of acetoacetyl-CoA synthetase from rat liver." FEBS Lett. 466(2-3):239-243. PMID:10682835
  7. [ + ] Nakamoto M, et al. (1999) "Effects of development on acetoacetyl-CoA synthetase biosynthesis in rat liver." Biol Pharm Bull. 22(9):981-983. PMID:10513626
  8. [ + ] Lukivskaya OYa, et al. (1993) "Utilization of ketone bodies by the rat liver, brain and heart in chronic alcohol intoxication." Alcohol Alcohol. 28(4):431-436. PMID:8104400
  9. [ + ] Salam WH, et al. (1989) "Stimulation of hepatic cholesterol biosynthesis by fatty acids. Effects of oleate on cytoplasmic acetoacetyl-CoA thiolase, acetoacetyl-CoA synthetase and hydroxymethylglutaryl-CoA synthase." Biochem J. 258(2):563-568. PMID:2565110
  10. [ + ] Ito M, et al. (1986) "Acetoacetyl-CoA synthetase specific activity and concentration in rat tissues." Biochim Biophys Acta. 876(2):280-287. PMID:3082367
  11. [ + ] Bergstrom JD, et al. (1984) "The regulation of acetoacetyl-CoA synthetase activity by modulators of cholesterol synthesis in vivo and the utilization of acetoacetate for cholesterogenesis." J Biol Chem. 259(23):14548-14553. PMID:6501306