Freq | GeneID:65153 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 65153 Official Symbol Freq
Locus N/A Gene Type protein-coding
Synonyms Ncs1
Full Name frequenin homolog (Drosophila)
Description frequenin homolog (Drosophila)
Chromosome 3p12
Also Known As neuronal calcium sensor-1
Summary mediates increased pohosphinositide turnover and Ca2+ signaling; plays a role in positive regulation of exocytosis [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 5719

ID Symbol Protein Species
GeneID:14299 Freq NP_062655.1 Mus musculus
GeneID:23413 FREQ NP_055101.2 Homo sapiens
GeneID:32797 Frq1 NP_573271.1 Drosophila melanogaster
GeneID:32799 Frq2 NP_525093.1 Drosophila melanogaster
GeneID:65153 Freq NP_077342.1 Rattus norvegicus
GeneID:180448 ncs-1 NP_508186.1 Caenorhabditis elegans
GeneID:396336 FREQ NP_990708.1 Gallus gallus
GeneID:491294 FREQ XP_548415.2 Canis lupus familiaris
GeneID:526544 FREQ NP_001035637.1 Bos taurus
GeneID:553174 freqb NP_001018350.1 Danio rerio
GeneID:1278632 AgaP_ENSANGG00000017071 XP_318275.1 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab34743 Frequenin antibody (HRP) (ab34743); Chicken polyclonal to Frequenin (HRP)
2 abcam ab18060 Frequenin antibody (ab18060); Chicken polyclonal to Frequenin
3 abcam ab5807 Frequenin antibody (ab5807); Rabbit polyclonal to Frequenin
4 abgent AP1551c NCS1 Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
5 sigma N4285 Anti-NCS-1 antibody produced in rabbit ;

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0030424 Component axon
GO:0030054 Component cell junction
GO:0005829 Component cytosol
GO:0030425 Component dendrite
GO:0005794 Component Golgi apparatus
GO:0032580 Component Golgi cisterna membrane
GO:0005886 Component plasma membrane
GO:0014069 Component postsynaptic density
GO:0045211 Component postsynaptic membrane
GO:0045202 Component synapse
GO:0008427 Function calcium-dependent protein kinase inhibitor activity
GO:0005509 Function calcium ion binding
GO:0005515 Function protein binding
GO:0048015 Process phosphoinositide-mediated signaling
GO:0045921 Process positive regulation of exocytosis

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_024366  UCSC Browser NP_077342

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000011648 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSRNOT00000011648 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSRNOT00000011648 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENSRNOT00000011648 MI0003639 hsa-miR-625 AGGGGGAAAGUUCUAUAGUCC
ENSRNOT00000011648 MI0003654 hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU
ENSRNOT00000011648 MI0003665 hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC
ENSRNOT00000011648 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENSRNOT00000011648 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENSRNOT00000011648 MI0005755 hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC
ENSRNOT00000011648 MI0004693 mmu-miR-709 GGAGGCAGAGGCAGGAGGA
ENSRNOT00000011648 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC
ENSRNOT00000011648 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENSRNOT00000011648 MI0000886 rno-miR-101a UACAGUACUGUGAUAACUGAA
ENSRNOT00000011648 MI0000611 rno-miR-140 CAGUGGUUUUACCCUAUGGUAG
ENSRNOT00000011648 MI0000953 rno-miR-181a* ACCAUCGACCGUUGAUUGUACC
ENSRNOT00000011648 MI0000928 rno-miR-183 UAUGGCACUGGUAGAAUUCACU
ENSRNOT00000011648 MI0000969 rno-miR-298 GGCAGAGGAGGGCUGUUCUUCCC
ENSRNOT00000011648 MI0000594 rno-miR-324-3p CCACUGCCCCAGGUGCUGCUGG
ENSRNOT00000011648 MI0006158 rno-miR-673 CUCACAGCUCCGGUCCUUGGAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

L27421   NM_024366   X82188  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Aravind P, et al. (2008) "Regulatory and structural EF-hand motifs of neuronal calcium sensor-1: Mg 2+ modulates Ca 2+ binding, Ca 2+ -induced conformational changes, and equilibrium unfolding transitions." J Mol Biol. 376(4):1100-1115. PMID:18199453
  2. [ + ] Rosa DV, et al. (2007) "NCS-1 expression in rat brain after electroconvulsive stimulation." Neurochem Res. 32(1):81-85. PMID:17160505
  3. [ + ] de Barry J, et al. (2006) "Functional implication of neuronal calcium sensor-1 and phosphoinositol 4-kinase-beta interaction in regulated exocytosis of PC12 cells." J Biol Chem. 281(26):18098-18111. PMID:16638749
  4. [ + ] Schlecker C, et al. (2006) "Neuronal calcium sensor-1 enhancement of InsP3 receptor activity is inhibited by therapeutic levels of lithium." J Clin Invest. 116(6):1668-1674. PMID:16691292
  5. [ + ] Kapp-Barnea Y, et al. (2006) "Neuronal calcium sensor-1 and phosphatidylinositol 4-kinase beta stimulate extracellular signal-regulated kinase 1/2 signaling by accelerating recycling through the endocytic recycling compartment." Mol Biol Cell. 17(9):4130-4141. PMID:16837555
  6. [ + ] Nakamura TY, et al. (2006) "Novel role of neuronal Ca2+ sensor-1 as a survival factor up-regulated in injured neurons." J Cell Biol. 172(7):1081-1091. PMID:16549499
  7. [ + ] Hui H, et al. (2006) "Calcium-sensing mechanism in TRPC5 channels contributing to retardation of neurite outgrowth." J Physiol. 572(Pt 1):165-172. PMID:16469785
  8. [ + ] Zheng Q, et al. (2005) "Neuronal calcium sensor-1 facilitates neuronal exocytosis through phosphatidylinositol 4-kinase." J Neurochem. 92(3):442-451. PMID:15659215
  9. [ + ] Garcia N, et al. (2005) "Localization of neuronal calcium sensor-1 at the adult and developing rat neuromuscular junction." J Neurosci Res. 82(1):1-9. PMID:16088942
  10. [ + ] Brackmann M, et al. (2004) "MGluRs regulate the expression of neuronal calcium sensor proteins NCS-1 and VILIP-1 and the immediate early gene arg3.1/arc in the hippocampus in vivo." Biochem Biophys Res Commun. 322(3):1073-1079. PMID:15336574
  11. [ + ] Sippy T, et al. (2003) "Acute changes in short-term plasticity at synapses with elevated levels of neuronal calcium sensor-1." Nat Neurosci. 6(10):1031-1038. PMID:12947410
  12. [ + ] Rajebhosale M, et al. (2003) "Phosphatidylinositol 4-OH kinase is a downstream target of neuronal calcium sensor-1 in enhancing exocytosis in neuroendocrine cells." J Biol Chem. 278(8):6075-6084. PMID:12471042
  13. [ + ] Kawasaki T, et al. (2003) "Spatiotemporal distribution of neuronal calcium sensor-1 in the developing rat spinal cord." J Comp Neurol. 460(4):465-475. PMID:12717707
  14. [ + ] Ren X, et al. (2003) "Effective association of Kv channel-interacting proteins with Kv4 channel is mediated with their unique core peptide." J Biol Chem. 278(44):43564-43570. PMID:12928444
  15. [ + ] Kapp-Barnea Y, et al. (2003) "Neuronal calcium sensor-1 and phosphatidylinositol 4-kinase beta regulate IgE receptor-triggered exocytosis in cultured mast cells." J Immunol. 171(10):5320-5327. PMID:14607934
  16. [ + ] Taverna E, et al. (2002) "Neuronal calcium sensor 1 and phosphatidylinositol 4-OH kinase beta interact in neuronal cells and are translocated to membranes during nucleotide-evoked exocytosis." J Cell Sci. 115(Pt 20):3909-3922. PMID:12244129
  17. [ + ] Koizumi S, et al. (2002) "Mechanisms underlying the neuronal calcium sensor-1-evoked enhancement of exocytosis in PC12 cells." J Biol Chem. 277(33):30315-30324. PMID:12034721
  18. [ + ] Lourenssen S, et al. (2002) "Intestinal inflammation modulates expression of the synaptic vesicle protein neuronal calcium sensor-1." Am J Physiol Gastrointest Liver Physiol. 282(6):G1097-G1104. PMID:12016136
  19. [ + ] Scalettar BA, et al. (2002) "Neuronal calcium sensor-1 binds to regulated secretory organelles and functions in basal and stimulated exocytosis in PC12 cells." J Cell Sci. 115(Pt 11):2399-2412. PMID:12006624
  20. [ + ] Chen C, et al. (2002) "Human neuronal calcium sensor-1 shows the highest expression level in cerebral cortex." Neurosci Lett. 319(2):67-70. PMID:11825672
  21. [ + ] McFerran BW, et al. (1999) "Neuronal Ca(2+) sensor 1. Characterization of the myristoylated protein, its cellular effects in permeabilized adrenal chromaffin cells, Ca(2+)-independent membrane association, and interaction with binding proteins, suggesting a role in rapid Ca(2+) signal transduction." J Biol Chem. 274(42):30258-30265. PMID:10514519
  22. [ + ] McFerran BW, et al. (1998) "Neuronal Ca2+ sensor 1, the mammalian homologue of frequenin, is expressed in chromaffin and PC12 cells and regulates neurosecretion from dense-core granules." J Biol Chem. 273(35):22768-22772. PMID:9712909
  23. [ + ] De Castro E, et al. (1995) "Regulation of rhodopsin phosphorylation by a family of neuronal calcium sensors." Biochem Biophys Res Commun. 216(1):133-140. PMID:7488079