ACD | GeneID:65057 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 65057 Official Symbol ACD
Locus N/A Gene Type protein-coding
Synonyms PIP1; PTOP; TINT1; TPP1
Full Name adrenocortical dysplasia homolog (mouse)
Description adrenocortical dysplasia homolog (mouse)
Chromosome 16q22.1
Also Known As POT1 and TIN2 organizing protein; TIN2 interacting protein 1; adrenocortical dysplasia homolog
Summary This gene encodes a protein that is involved in telomere function. This protein is one of six core proteins in the telosome/shelterin telomeric complex, which functions to maintain telomere length and to protect telomere ends. Through its interaction with other components, this protein plays a key role in the assembly and stabilization of this complex, and it mediates the access of telomerase to the telomere. Multiple transcript variants encoding different isoforms have been found for this gene. This gene, which is also referred to as TPP1, is distinct from the unrelated TPP1 gene on chromosome 11, which encodes tripeptidyl-peptidase I. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 23391

ID Symbol Protein Species
GeneID:65057 ACD NP_001075955.1 Homo sapiens
GeneID:307798 Acd NP_001032270.1 Rattus norvegicus
GeneID:487931 ACD XP_853906.1 Canis lupus familiaris
GeneID:497652 Acd NP_001012656.1 Mus musculus
GeneID:510353 ACD XP_587483.1 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab57595 PTOP antibody (ab57595); Mouse monoclonal to PTOP
2 abcam ab39042 PTOP antibody (ab39042); Rabbit polyclonal to PTOP
3 abnova H00065057-M01A ACD monoclonal antibody (M01A), clone 1C11-1A7; Mouse monoclonal antibody raised against a full-length recombinant ACD.
4 abnova H00065057-M02 ACD monoclonal antibody (M02), clone 1D8-1B6; Mouse monoclonal antibody raised against a full length recombinant ACD.
5 scbt ACD ACD Antibody / ACD Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACD Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACD Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005694 Component chromosome
GO:0000781 Component chromosome, telomeric region
GO:0000783 Component nuclear telomere cap complex
GO:0005654 Component nucleoplasm
GO:0005634 Component nucleus
GO:0003677 Function DNA binding
GO:0070182 Function DNA polymerase binding
GO:0005515 Function protein binding
GO:0030326 Process embryonic limb morphogenesis
GO:0006886 Process intracellular protein transport
GO:0032211 Process negative regulation of telomere maintenance via telomerase
GO:0060381 Process positive regulation of single-stranded telomeric DNA binding
GO:0051973 Process positive regulation of telomerase activity
GO:0031848 Process protection from non-homologous end joining at telomere
GO:0070198 Process protein localization to telomere
GO:0035282 Process segmentation
GO:0001501 Process skeletal system development
GO:0032202 Process telomere assembly
GO:0001655 Process urogenital system development

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001082486  UCSC Browser NP_001075955
2 NM_001082487  UCSC Browser NP_001075956
3 NM_022914  UCSC Browser NP_075065

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000219251 MI0000442 hsa-miR-122 UGGAGUGUGACAAUGGUGUUUG
ENST00000219251 MI0001721 hsa-miR-431 UGUCUUGCAGGCCGUCAUGCA
ENST00000219251 MI0003562 hsa-miR-556-5p GAUGAGCUCAUUGUAAUAUGAG
ENST00000219251 MI0003581 hsa-miR-574-5p UGAGUGUGUGUGUGUGAGUGUGU
ENST00000219251 MI0003607 hsa-miR-595 GAAGUGUGCCGUGGUGUGUCU
ENST00000219251 MI0005537 hsa-miR-888 UACUCAAAAAGCUGUCAGUCA
ENST00000219251 MI0000391 mmu-miR-293 AGUGCCGCAGAGUUUGUAGUGU
ENST00000219251 MI0004693 mmu-miR-709 GGAGGCAGAGGCAGGAGGA
ENST00000219251 MI0004554 mmu-miR-759 GCAGAGUGCAAACAAUUUUGAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
POT1 ACD / POT1 Affinity Capture-Western Liu D (2004)
POT1 POT1 / ACD Affinity Capture-Western Ye JZ (2004)
POT1 ACD / POT1 Reconstituted Complex Liu D (2004)
POT1 ACD / POT1 Two-hybrid Liu D (2004)
POT1 POT1 / ACD Two-hybrid Rual JF (2005)
POT1 POT1 / ACD Two-hybrid Ye JZ (2004)
TERF1 ACD / TERF1 Affinity Capture-Western Ye JZ (2004)
TINF2 TINF2 / ACD Affinity Capture-MS Liu D (2004)
TINF2 ACD / TINF2 Affinity Capture-Western Liu D (2004)
TINF2 ACD / TINF2 Affinity Capture-Western Ye JZ (2004)
TINF2 TINF2 / ACD Affinity Capture-Western Ye JZ (2004)
TINF2 TINF2 / ACD Two-hybrid Ye JZ (2004)
XRCC6 ACD / XRCC6 Two-hybrid Stelzl U (2005)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Keegan CE, et al. (2007) "Novel polymorphisms and lack of mutations in the ACD gene in patients with ACTH resistance syndromes." Clin Endocrinol (Oxf). 67(2):168-174. PMID:17466001
  2. [ + ] Cristofari G, et al. (2007) "Telomerase unplugged." ACS Chem Biol. 2(3):155-158. PMID:17373762
  3. [ + ] Wang F, et al. (2007) "The POT1-TPP1 telomere complex is a telomerase processivity factor." Nature. 445(7127):506-510. PMID:17237768
  4. [ + ] Xin H, et al. (2007) "TPP1 is a homologue of ciliate TEBP-beta and interacts with POT1 to recruit telomerase." Nature. 445(7127):559-562. PMID:17237767
  5. [ + ] Else T, et al. (2007) "Tpp1/Acd maintains genomic stability through a complex role in telomere protection." Chromosome Res. 15(8):1001-1013. PMID:18185984
  6. [ + ] Hockemeyer D, et al. (2007) "Telomere protection by mammalian Pot1 requires interaction with Tpp1." Nat Struct Mol Biol. 14(8):754-761. PMID:17632522
  7. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  8. [ + ] Hutz JE, et al. (2006) "IMAGe association and congenital adrenal hypoplasia: no disease-causing mutations found in the ACD gene." Mol Genet Metab. 88(1):66-70. PMID:16504561
  9. [ + ] Lim J, et al. (2006) "A protein-protein interaction network for human inherited ataxias and disorders of Purkinje cell degeneration." Cell. 125(4):801-814. PMID:16713569
  10. [ + ] Songyang Z, et al. (2006) "Inside the mammalian telomere interactome: regulation and regulatory activities of telomeres." Crit Rev Eukaryot Gene Expr. 16(2):103-118. PMID:16749892
  11. [ + ] O'Connor MS, et al. (2006) "A critical role for TPP1 and TIN2 interaction in high-order telomeric complex assembly." Proc Natl Acad Sci U S A. 103(32):11874-11879. PMID:16880378
  12. [ + ] Rual JF, et al. (2005) "Towards a proteome-scale map of the human protein-protein interaction network." Nature. 437(7062):1173-1178. PMID:16189514
  13. [ + ] Keegan CE, et al. (2005) "Urogenital and caudal dysgenesis in adrenocortical dysplasia (acd) mice is caused by a splicing mutation in a novel telomeric regulator." Hum Mol Genet. 14(1):113-123. PMID:15537664
  14. [ + ] de Lange T, et al. (2005) "Shelterin: the protein complex that shapes and safeguards human telomeres." Genes Dev. 19(18):2100-2110. PMID:16166375
  15. [ + ] Stelzl U, et al. (2005) "A human protein-protein interaction network: a resource for annotating the proteome." Cell. 122(6):957-968. PMID:16169070
  16. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  17. [ + ] Houghtaling BR, et al. (2004) "A dynamic molecular link between the telomere length regulator TRF1 and the chromosome end protector TRF2." Curr Biol. 14(18):1621-1631. PMID:15380063
  18. [ + ] Ye JZ, et al. (2004) "POT1-interacting protein PIP1: a telomere length regulator that recruits POT1 to the TIN2/TRF1 complex." Genes Dev. 18(14):1649-1654. PMID:15231715
  19. [ + ] Liu D, et al. (2004) "PTOP interacts with POT1 and regulates its localization to telomeres." Nat Cell Biol. 6(7):673-680. PMID:15181449
  20. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  21. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  22. [ + ] Yu W, et al. (1997) "Large-scale concatenation cDNA sequencing." Genome Res. 7(4):353-358. PMID:9110174
  23. [ + ] Andersson B, et al. (1996) "A "double adaptor" method for improved shotgun library construction." Anal Biochem. 236(1):107-113. PMID:8619474