ACBD3 | GeneID:64746 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 64746 Official Symbol ACBD3
Locus N/A Gene Type protein-coding
Synonyms GCP60; GOCAP1; GOLPH1; PAP7
Full Name acyl-Coenzyme A binding domain containing 3
Description acyl-Coenzyme A binding domain containing 3
Chromosome 1q42.12
Also Known As OTTHUMP00000035668; PBR associated protein; PKA (RIalpha)-associated protein; golgi complex associated protein 1, 60kDa; golgi phosphoprotein 1; golgi resident protein GCP60; peripherial benzodiazepine receptor associated protein
Summary The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is involved in the maintenance of Golgi structure and function through its interaction with the integral membrane protein giantin. It may also be involved in the hormonal regulation of steroid formation. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11227

ID Symbol Protein Species
GeneID:32983 CG14232 NP_608348.1 Drosophila melanogaster
GeneID:64746 ACBD3 NP_073572.2 Homo sapiens
GeneID:170760 Acbd3 NP_573488.1 Mus musculus
GeneID:178416 Y41E3.7 NP_001041025.1 Caenorhabditis elegans
GeneID:289312 Acbd3 NP_878263.1 Rattus norvegicus
GeneID:421317 ACBD3 NP_001026214.1 Gallus gallus
GeneID:560569 zgc:162964 NP_001082856.1 Danio rerio
GeneID:611888 ACBD3 XP_854705.1 Canis lupus familiaris
GeneID:737563 ACBD3 XP_001140558.1 Pan troglodytes
GeneID:783375 ACBD3 XP_001251579.1 Bos taurus
GeneID:1273857 AgaP_AGAP003185 XP_312883.2 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab57568 ACBD3 antibody (ab57568); Mouse monoclonal to ACBD3
2 abnova H00064746-M01 ACBD3 monoclonal antibody (M01), clone 2G2; Mouse monoclonal antibody raised against a partial recombinant ACBD3.
3 abnova H00064746-M02 ACBD3 monoclonal antibody (M02), clone 2H2; Mouse monoclonal antibody raised against a partial recombinant ACBD3.
4 scbt ACBD3 ACBD3 Antibody / ACBD3 Antibodies;
5 sigma HPA015594 Anti-ACBD3 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACBD3 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACBD3 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005794 Component Golgi apparatus
GO:0000139 Component Golgi membrane
GO:0016020 Component membrane
GO:0005739 Component mitochondrion
GO:0000062 Function acyl-CoA binding
GO:0005515 Function protein binding
GO:0006694 Process steroid biosynthetic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_022735  UCSC Browser NP_073572 B2RB29   Q9H3P7  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000366812 MI0005568 hsa-miR-301b CAGUGCAAUGAUAUUGUCAAAGC
ENST00000366812 MI0001145 hsa-miR-384 AUUCCUAGAAAUUGUUCAUA
ENST00000366812 MI0003675 hsa-miR-411* UAUGUAACACGGUCCACUAACC
ENST00000366812 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENST00000366812 MI0003196 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENST00000366812 MI0005530 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENST00000366812 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000366812 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000366812 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENST00000366812 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ACBD3 mRNA
17562736
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of ACBD3 mRNA
17555576
Iron
  • Nitric Oxide promotes the reaction [[RASD1 protein binds to ACBD3 protein binds to SLC11A2 protein] which results in increased uptake of Iron]
16908409
Nitric Oxide
  • Nitric Oxide promotes the reaction [[RASD1 protein binds to ACBD3 protein binds to SLC11A2 protein] which results in increased uptake of Iron]
16908409
testosterone enanthate
  • testosterone enanthate affects the expression of ACBD3 mRNA
17440010

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
HIV Wasting Syndrome inferred via testosterone enanthate 17440010
Alzheimer Disease inferred via Nitric Oxide 17556102
Breast Neoplasms inferred via Nitric Oxide 15631943
Cholestasis inferred via Nitric Oxide 16919318
Dementia, Vascular inferred via Nitric Oxide 17556102
Hypertension, Pulmonary inferred via Nitric Oxide 15838368
Intestinal Diseases inferred via Nitric Oxide 10210152
Lymphoma inferred via Nitric Oxide 16166326
alpha 1-Antitrypsin Deficiency inferred via Iron 16640825
Alzheimer Disease inferred via Iron 16640825, 16563566
Anemia inferred via Iron 16566752, 16434484
Anemia, Iron-Deficiency inferred via Iron 17162259, 17375513, 17163184, 17147795, 16569441
Anemia, Sideroblastic inferred via Iron 16910769
Arrhythmias, Cardiac inferred via Iron 16604332
Atherosclerosis inferred via Iron 16640825, 16632123
Bacterial Infections inferred via Iron 16640825
Cardiomyopathies inferred via Iron 16640825
Cardiomyopathy, Dilated inferred via Iron 16604332
Colonic Neoplasms inferred via Iron 16640825
Diabetes Mellitus inferred via Iron 16640825, 16604332
Diabetes Mellitus, Type 1 inferred via Iron 16506275
Diabetes Mellitus, Type 2 inferred via Iron 16506275
Fatty Liver inferred via Iron 16640825
Friedreich Ataxia inferred via Iron 16640825, 16604332
Hemochromatosis inferred via Iron 17236123, 16640825, 16574947, 16604332, 17053826, 17255318
Hemosiderosis inferred via Iron 16604332
Hepatitis, Viral, Human inferred via Iron 16640825
Hepatolenticular Degeneration inferred via Iron 17182432
Hepatomegaly inferred via Iron 16890145
HIV Infections inferred via Iron 16597321
Hypogonadism inferred via Iron 16640825
Hypothyroidism inferred via Iron 16640825
Iron Metabolism Disorders inferred via Iron 17163184
Lewy Body Disease inferred via Iron 16563566
Liver Cirrhosis inferred via Iron 16640825
Liver Diseases, Alcoholic inferred via Iron 17207112, 16737972
Liver Neoplasms inferred via Iron 16640825
Lung Neoplasms inferred via Iron 16640825
Macular Degeneration inferred via Iron 16640825
Multiple Sclerosis, Chronic Progressive inferred via Iron 17086897
Mycoses inferred via Iron 16640825
Myocardial Ischemia inferred via Iron 16604332
Myocardial Reperfusion Injury inferred via Iron 16604332
Nephrotic Syndrome inferred via Iron 17178036
Neurodegenerative Diseases inferred via Iron 17296847, 16604332
Osteoarthritis inferred via Iron 16640825
Osteoporosis inferred via Iron 16640825, 16648989
Parkinson Disease inferred via Iron 16640825, 16563566
Pituitary Diseases inferred via Iron 16604332
Poisoning inferred via Iron 16604332
Porphyria Cutanea Tarda inferred via Iron 16640825
Pre-Eclampsia inferred via Iron 16640825
Protozoan Infections inferred via Iron 16640825
Restless Legs Syndrome inferred via Iron 16930377
Sudden Infant Death inferred via Iron 16640825
Tuberculosis inferred via Iron 16597321
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16919318, 16105132, 11677210, 15861022, 17333356, 17681005
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16227642, 15968718, 16177239, 16081117, 17522070, 14986274, 17562736
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
GOLGB1 GOLGB1 / ACBD3 Far Western Sohda M (2001)
GOLGB1 GOLGB1 / ACBD3 Two-hybrid Sohda M (2001)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Skibola CF, et al. (2008) "Polymorphisms in the estrogen receptor 1 and vitamin C and matrix metalloproteinase gene families are associated with susceptibility to lymphoma." PLoS ONE. 3(7):e2816. PMID:18636124
  2. [ + ] Sbodio JI, et al. (2007) "Identification of a redox-sensitive cysteine in GCP60 that regulates its interaction with golgin-160." J Biol Chem. 282(41):29874-29881. PMID:17711851
  3. [ + ] Gregory SG, et al. (2006) "The DNA sequence and biological annotation of human chromosome 1." Nature. 441(7091):315-321. PMID:16710414
  4. [ + ] Sbodio JI, et al. (2006) "GCP60 preferentially interacts with a caspase-generated golgin-160 fragment." J Biol Chem. 281(38):27924-27931. PMID:16870622
  5. [ + ] Colland F, et al. (2004) "Functional proteomics mapping of a human signaling pathway." Genome Res. 14(7):1324-1332. PMID:15231748
  6. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  7. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  8. [ + ] Liu J, et al. (2003) "Molecular cloning, chromosomal localization of human peripheral-type benzodiazepine receptor and PKA regulatory subunit type 1A (PRKAR1A)-associated protein PAP7, and studies in PRKAR1A mutant cells and tissues." FASEB J. 17(9):1189-1191. PMID:12692076
  9. [ + ] Gevaert K, et al. (2003) "Exploring proteomes and analyzing protein processing by mass spectrometric identification of sorted N-terminal peptides." Nat Biotechnol. 21(5):566-569. PMID:12665801
  10. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  11. [ + ] Li H, et al. (2001) "Identification, localization, and function in steroidogenesis of PAP7: a peripheral-type benzodiazepine receptor- and PKA (RIalpha)-associated protein." Mol Endocrinol. 15(12):2211-2228. PMID:11731621
  12. [ + ] Sohda M, et al. (2001) "Identification and characterization of a novel Golgi protein, GCP60, that interacts with the integral membrane protein giantin." J Biol Chem. 276(48):45298-45306. PMID:11590181