ABCG8 | GeneID:64241 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 64241 Official Symbol ABCG8
Locus N/A Gene Type protein-coding
Synonyms GBD4; MGC142217; STSL
Full Name ATP-binding cassette, sub-family G (WHITE), member 8
Description ATP-binding cassette, sub-family G (WHITE), member 8
Chromosome 2p21
Also Known As ATP-binding cassette sub-family G member 8; ATP-binding cassette, subfamily G, member 8; sterolin 2
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. The protein encoded by this gene functions to exclude non-cholesterol sterol entry at the intestinal level, promote excretion of cholesterol and sterols into bile, and to facilitate transport of sterols back into the intestinal lumen. It is expressed in a tissue-specific manner in the liver, intestine, and gallbladder. This gene is tandemly arrayed on chromosome 2, in a head-to-head orientation with family member ABCG5. Mutations in this gene may contribute to sterol accumulation and atherosclerosis, and have been observed in patients with sitosterolemia. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 23361

ID Symbol Protein Species
GeneID:64241 ABCG8 NP_071882.1 Homo sapiens
GeneID:67470 Abcg8 NP_080456.1 Mus musculus
GeneID:155192 Abcg8 NP_569098.2 Rattus norvegicus
GeneID:421402 ABCG8 XP_419458.2 Gallus gallus
GeneID:470363 ABCG8 XP_525745.2 Pan troglodytes
GeneID:474571 ABCG8 XP_531799.2 Canis lupus familiaris
GeneID:508829 ABCG8 NP_001019834.1 Bos taurus
GeneID:814660 AT2G01320 NP_178241.1 Arabidopsis thaliana
GeneID:854080 YOL075C NP_014567.1 Saccharomyces cerevisiae
GeneID:2682022 MGG_10410 XP_366191.1 Magnaporthe grisea
GeneID:2892176 KLLA0C04477g XP_452398.1 Kluyveromyces lactis
GeneID:4326045 Os01g0121700 NP_001041878.1 Oryza sativa
GeneID:100136850 abcg8 NP_001108041.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab45280 ABCG8 antibody (ab45280); Rabbit polyclonal to ABCG8
2 abcam ab5362 ABCG8 antibody (ab5362); Rabbit polyclonal to ABCG8
3 scbt ABCG8 ABCG8 Antibody / ABCG8 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCG8 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCG8 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016324 Component apical plasma membrane
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0017127 Function cholesterol transporter activity
GO:0046982 Function protein heterodimerization activity
GO:0033344 Process cholesterol efflux
GO:0042632 Process cholesterol homeostasis
GO:0007588 Process excretion
GO:0045796 Process negative regulation of intestinal cholesterol absorption
GO:0015914 Process phospholipid transport
GO:0015918 Process sterol transport
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_022437  UCSC Browser NP_071882

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000272286 MI0000433 hsa-let-7g* CUGUACAGGCCACUGCCUUGC
ENST00000272286 MI0000103 hsa-miR-101* CAGUUAUCACAGUGCUGAUGCU
ENST00000272286 MI0000111 hsa-miR-105* ACGGAUGUUUGAGCAUGUGCUA
ENST00000272286 MI0000112 hsa-miR-105* ACGGAUGUUUGAGCAUGUGCUA
ENST00000272286 MI0000479 hsa-miR-150* CUGGUACAGGCCUGGGGGACAG
ENST00000272286 MI0000289 hsa-miR-181a* ACCAUCGACCGUUGAUUGUACC
ENST00000272286 MI0000072 hsa-miR-18a UAAGGUGCAUCUAGUGCAGAUAG
ENST00000272286 MI0001518 hsa-miR-18b UAAGGUGCAUCUAGUGCAGUUAG
ENST00000272286 MI0000079 hsa-miR-23a* GGGGUUCCUGGGGAUGGGAUUU
ENST00000272286 MI0000806 hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC
ENST00000272286 MI0000805 hsa-miR-342-3p UCUCACACAGAAAUCGCACCCGU
ENST00000272286 MI0001145 hsa-miR-384 AUUCCUAGAAAUUGUUCAUA
ENST00000272286 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENST00000272286 MI0003127 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENST00000272286 MI0003128 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENST00000272286 MI0003574 hsa-miR-568 AUGUAUAAAUGUAUACACAC
ENST00000272286 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENST00000272286 MI0003643 hsa-miR-629* GUUCUCCCAACGUAAGCCCAGC
ENST00000272286 MI0003681 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG
ENST00000272286 MI0003763 hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU
ENST00000272286 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENST00000272286 MI0005527 hsa-miR-886-5p CGGGUCGGAGUUAGCUCAAGCGG
ENST00000272286 MI0000391 mmu-miR-293 AGUGCCGCAGAGUUUGUAGUGU
ENST00000272286 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG
ENST00000272286 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENST00000272286 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
3-DOXYLANDROSTANOL
  • 3-DOXYLANDROSTANOL results in increased activity of [ABCG5 protein binds to ABCG8 protein]
17055487
Acetaminophen
  • Acetaminophen affects the expression of ABCG8 mRNA
17562736
Androstenedione
  • Androstenedione results in increased activity of [ABCG5 protein binds to ABCG8 protein]
17055487
Bezafibrate
  • Bezafibrate does not affect the expression of ABCG8 mRNA
15242490
Cholates
  • Cholates promotes the reaction [ABCG8 protein results in increased secretion of Cholesterol]
  • Cholates results in increased expression of ABCG8 mRNA
  • Cholates results in increased expression of ABCG8 protein
15611112
Cholesterol
  • [Diosgenin results in increased expression of ABCG8 mRNA] which results in increased secretion of Cholesterol
  • [Ethinyl Estradiol results in decreased expression of ABCG8 mRNA] which results in decreased secretion of Cholesterol
12963437
Cholesterol
  • Cholesterol results in increased expression of ABCG8 mRNA
15342687
Cholesterol
  • Cholesterol results in increased expression of ABCG8 mRNA
  • Cholesterol results in decreased expression of ABCG8 mRNA
  • Cholesterol results in increased expression of ABCG8 mRNA
  • [ABCG5 protein binds to ABCG8 protein] which affects the transport of Cholesterol
15683829
Cholesterol
  • ABCG8 protein results in increased secretion of Cholesterol
  • Cholates promotes the reaction [ABCG8 protein results in increased secretion of Cholesterol]
  • Diosgenin promotes the reaction [ABCG8 protein results in increased secretion of Cholesterol]
15611112
Cholesterol
  • ABCG8 protein affects the export of Cholesterol
15696852
Corn Oil
  • Corn Oil affects the expression of ABCG8 mRNA
16360708
Dehydroepiandrosterone
  • Dehydroepiandrosterone results in increased activity of [ABCG5 protein binds to ABCG8 protein]
17055487
Dexamethasone
  • Dexamethasone does not affect the expression of ABCG8 mRNA
15683829
Dietary Fats
  • Dietary Fats results in decreased expression of ABCG8 mRNA
18457598
Diosgenin
  • Diosgenin promotes the reaction [ABCG8 protein results in increased secretion of Cholesterol]
15611112
Diosgenin
  • Diosgenin does not affect the expression of ABCG8 mRNA
15611112, 12763362
Diosgenin
  • [Ethinyl Estradiol co-treated with Diosgenin] results in decreased expression of ABCG8 mRNA
16105132
Diosgenin
  • Diosgenin does not affect the reaction [Ethinyl Estradiol results in decreased expression of ABCG8 mRNA]
  • Diosgenin results in increased expression of ABCG8 mRNA
  • [Diosgenin results in increased expression of ABCG8 mRNA] which results in increased secretion of Cholesterol
12963437
Ethinyl Estradiol
  • Diosgenin does not affect the reaction [Ethinyl Estradiol results in decreased expression of ABCG8 mRNA]
  • [Ethinyl Estradiol results in decreased expression of ABCG8 mRNA] which results in decreased secretion of Cholesterol
12963437
Ethinyl Estradiol
  • [Ethinyl Estradiol co-treated with Diosgenin] results in decreased expression of ABCG8 mRNA
16105132
Ethinyl Estradiol
  • ESR1 protein promotes the reaction [Ethinyl Estradiol results in decreased expression of ABCG8 mRNA]
  • Ethinyl Estradiol results in decreased expression of ABCG8 mRNA
16606610
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of ABCG8 mRNA
16105132, 12963437
GW 3965
  • GW 3965 results in increased expression of ABCG8 mRNA
15633131
perfluorooctanoic acid
  • perfluorooctanoic acid results in decreased expression of ABCG8 mRNA
17681415
Phytosterols
  • [ABCG5 protein binds to ABCG8 protein] which affects the transport of Phytosterols
15683829
pirinixic acid
  • pirinixic acid results in increased expression of ABCG8 mRNA
18301758
plant stanol ester
  • plant stanol ester results in decreased expression of ABCG8 mRNA
15342687
Pravastatin
  • Pravastatin results in increased expression of ABCG8 mRNA
15242490
Pregnenolone Carbonitrile
  • Pregnenolone Carbonitrile results in increased expression of ABCG8 mRNA
15683829
Progesterone
  • Progesterone results in decreased activity of [ABCG5 protein binds to ABCG8 protein]
17055487
Spironolactone
  • Spironolactone results in decreased expression of ABCG8 mRNA
15683829
Sterols
  • ABCG8 protein affects the export of Sterols
15737409
Sterols
  • ABCG8 protein affects the export of Sterols
15930516
Ursodeoxycholic Acid
  • Ursodeoxycholic Acid affects the expression of ABCG8 mRNA
15452192
Vanadates
  • Vanadates results in decreased activity of [ABCG5 protein binds to ABCG8 protein]
17055487

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Gallstones marker 17632509
SITOSTEROLEMIA marker
Cholestasis inferred via Ursodeoxycholic Acid 16487557
Cholestasis, Intrahepatic inferred via Ursodeoxycholic Acid 14728856
Brain Hemorrhage, Traumatic inferred via Progesterone 17868700
Brain Injuries inferred via Progesterone 15665606, 15380490, 15845082
Breast Neoplasms inferred via Progesterone 17614352, 16175315, 15562024
Diabetic Neuropathies inferred via Progesterone 17187935
Encephalomyelitis, Autoimmune, Experimental inferred via Progesterone 17692515
Endometriosis inferred via Progesterone 16134523
Mammary Neoplasms, Experimental inferred via Progesterone 17203775, 11408345
Ovarian Neoplasms inferred via Progesterone 17393432, 16525653
Salivary Gland Neoplasms inferred via Progesterone 18045962
Spinal Cord Injuries inferred via Progesterone 15862959, 16503802
Hypercholesterolemia inferred via Pravastatin 17188708
Myocardial Infarction inferred via Pravastatin 17188708
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Edema inferred via perfluorooctanoic acid 17259670, 12083418
Hepatomegaly inferred via perfluorooctanoic acid 3609246
Hyperalgesia inferred via perfluorooctanoic acid 12083418
Inflammation inferred via perfluorooctanoic acid 12083418
Leydig Cell Tumor inferred via perfluorooctanoic acid 8812269
Liver Neoplasms inferred via perfluorooctanoic acid 14757943
Niemann-Pick Disease, Type C inferred via perfluorooctanoic acid 9802331
Prenatal Exposure Delayed Effects inferred via perfluorooctanoic acid 17132714
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16919318, 17333356, 17681005, 16105132, 11677210, 15861022
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Cholestasis inferred via Diosgenin 16105132
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Colonic Neoplasms inferred via Dexamethasone 15824018
Liver Cirrhosis, Experimental inferred via Dexamethasone 16718785
Lung Neoplasms inferred via Dexamethasone 15824018, 11195469
Multiple Myeloma inferred via Dexamethasone 15867202, 15744524, 16118317
Respiratory Distress Syndrome, Adult inferred via Dexamethasone 11700416
Adrenal Insufficiency inferred via Dehydroepiandrosterone 17302879
Diabetes Mellitus, Type 1 inferred via Dehydroepiandrosterone 16616286
Mammary Neoplasms, Experimental inferred via Dehydroepiandrosterone 16457693
Osteoporosis, Postmenopausal inferred via Dehydroepiandrosterone 16397352
Hypersensitivity, Delayed inferred via Corn Oil 11484837
Atherosclerosis inferred via Cholesterol 16632123
Hypercholesterolemia inferred via Cholesterol 16933029
Learning Disorders inferred via Cholesterol 17134702
Niemann-Pick Disease, Type C inferred via Cholesterol 9802331
Hepatitis, Toxic inferred via Acetaminophen 2444490, 14986274, 16227642, 15968718, 16177239, 17562736, 16081117, 17522070
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ABCG5 ABCG5 / ABCG8 Affinity Capture-Western Graf GA (2002)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Togo M, et al. (2009) "Identification of a novel mutation for phytosterolemia. Genetic analyses of 2 cases." Clin Chim Acta. 401(1-2):165-169. PMID:19111681
  2. [ + ] Kathiresan S, et al. (2009) "Common variants at 30 loci contribute to polygenic dyslipidemia." Nat Genet. 41(1):56-65. PMID:19060906
  3. [ + ] Yoshida T, et al. (2009) "Association of a polymorphism of the apolipoprotein E gene with chronic kidney disease in Japanese individuals with metabolic syndrome." Genomics. 93(3):221-226. PMID:19056482
  4. [ + ] Gylling H, et al. (2009) "Long-term consumption of plant stanol and sterol esters, vascular function and genetic regulation." Br J Nutr. 101(11):1688-1695. PMID:19019257
  5. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  6. [ + ] Sabeva NS, et al. (2009) "The ABCG5 ABCG8 sterol transporter and phytosterols: implications for cardiometabolic disease." Curr Opin Endocrinol Diabetes Obes. 16(2):172-177. PMID:19306529
  7. [ + ] Hirata T, et al. (2009) "Molecular mechanisms of subcellular localization of ABCG5 and ABCG8." Biosci Biotechnol Biochem. 73(3):619-626. PMID:19270375
  8. [ + ] Gylling H, et al. (2009) "The metabolism of plant sterols is disturbed in postmenopausal women with coronary artery disease." Metabolism. 58(3):401-407. PMID:19217458
  9. [ + ] Jiang ZY, et al. (2008) "Increased expression of LXR alpha, ABCG5, ABCG8, and SR-BI in the liver from normolipidemic, nonobese Chinese gallstone patients." J Lipid Res. 49(2):464-472. PMID:18007013
  10. [ + ] Caamano JM, et al. (2008) "Single nucleotide polymorphisms in ABCG5 and ABCG8 genes in Chilean subjects with polygenic hypercholesterolemia and controls." Clin Chem Lab Med. 46(11):1581-1585. PMID:19012522
  11. [ + ] Junyent M, et al. (2008) "The effects of ABCG5/G8 polymorphisms on plasma HDL cholesterol concentrations depend on smoking habit in the Boston Puerto Rican health study." J Lipid Res. ():. PMID:19005228
  12. [ + ] Koeijvoets KC, et al. (2008) "ABCG8 gene polymorphisms, plasma cholesterol concentrations, and risk of cardiovascular disease in familial hypercholesterolemia." Atherosclerosis. ():. PMID:18977479
  13. [ + ] Zhao HL, et al. (2008) "Genetic Variation in ABC G5/G8 and NPC1L1 Impact Cholesterol Response to Plant Sterols in Hypercholesterolemic Men." Lipids. 43(12):1155-1164. PMID:18850127
  14. [ + ] Hosgood HD 3rd, et al. (2008) "Pathway-based evaluation of 380 candidate genes and lung cancer susceptibility suggests the importance of the cell cycle pathway." Carcinogenesis. 29(10):1938-1943. PMID:18676680
  15. [ + ] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489
  16. [ + ] Rudkowska I, et al. (2008) "Association between non-responsiveness to plant sterol intervention and polymorphisms in cholesterol metabolism genes: a case-control study." Appl Physiol Nutr Metab. 33(4):728-734. PMID:18641716
  17. [ + ] Chen ZC, et al. (2008) "Significant association of ABCG8:D19H gene polymorphism with hypercholesterolemia and insulin resistance." J Hum Genet. 53(8):757-763. PMID:18581044
  18. [ + ] Rudkowska I, et al. (2008) "Polymorphisms in ABCG5/G8 transporters linked to hypercholesterolemia and gallstone disease." Nutr Rev. 66(6):343-348. PMID:18522623
  19. [ + ] Kuo KK, et al. (2008) "Significant association of ABCG5 604Q and ABCG8 D19H polymorphisms with gallstone disease." Br J Surg. 95(8):1005-1011. PMID:18457353
  20. [ + ] Santosa S, et al. (2007) "Single nucleotide polymorphisms in ABCG5 and ABCG8 are associated with changes in cholesterol metabolism during weight loss." J Lipid Res. 48(12):2607-2613. PMID:17827468
  21. [ + ] Buch S, et al. (2007) "A genome-wide association scan identifies the hepatic cholesterol transporter ABCG8 as a susceptibility factor for human gallstone disease." Nat Genet. 39(8):995-999. PMID:17632509
  22. [ + ] Lally SE, et al. (2007) "Sitosterol and cholesterol in chylomicrons of type 2 diabetic and non-diabetic subjects: the relationship with ATP binding cassette proteins G5 and G8 and Niemann-Pick C1-like 1 mRNA." Diabetologia. 50(1):217-219. PMID:17102949
  23. [ + ] Sumi K, et al. (2007) "Cooperative interaction between hepatocyte nuclear factor 4 alpha and GATA transcription factors regulates ATP-binding cassette sterol transporters ABCG5 and ABCG8." Mol Cell Biol. 27(12):4248-4260. PMID:17403900
  24. [ + ] Wang Y, et al. (2007) "ATP binding cassette G8 T400K polymorphism may affect the risk of gallstone disease among Chinese males." Clin Chim Acta. 384(1-2):80-85. PMID:17612515
  25. [ + ] Grunhage F, et al. (2007) "Increased gallstone risk in humans conferred by common variant of hepatic ATP-binding cassette transporter for cholesterol." Hepatology. 46(3):793-801. PMID:17626266
  26. [ + ] Tachibana S, et al. (2007) "Cholesterol and plant sterol efflux from cultured intestinal epithelial cells is mediated by ATP-binding cassette transporters." Biosci Biotechnol Biochem. 71(8):1886-1895. PMID:17690481
  27. [ + ] Muller M, et al. (2006) "Co-expression of human ABCG5 and ABCG8 in insect cells generates an androstan stimulated membrane ATPase activity." FEBS Lett. 580(26):6139-6144. PMID:17055487
  28. [ + ] Miettinen TA, et al. (2006) "Liver transplantation in a patient with sitosterolemia and cirrhosis." Gastroenterology. 130(2):542-547. PMID:16472606
  29. [ + ] Lally S, et al. (2006) "Messenger RNA levels of genes involved in dysregulation of postprandial lipoproteins in type 2 diabetes: the role of Niemann-Pick C1-like 1, ATP-binding cassette, transporters G5 and G8, and of microsomal triglyceride transfer protein." Diabetologia. 49(5):1008-1016. PMID:16518588
  30. [ + ] Engel T, et al. (2006) "Expression and functional characterization of ABCG1 splice variant ABCG1(666)." FEBS Lett. 580(18):4551-4559. PMID:16870176
  31. [ + ] Wang Z, et al. (2006) "Purification and ATP hydrolysis of the putative cholesterol transporters ABCG5 and ABCG8." Biochemistry. 45(32):9929-9939. PMID:16893193
  32. [ + ] Viturro E, et al. (2006) "Cholesterol and saturated fat intake determine the effect of polymorphisms at ABCG5/ABCG8 genes on lipid levels in children." Genet Med. 8(9):594-599. PMID:16980816
  33. [ + ] Acalovschi M, et al. (2006) "Are plasma lipid levels related to ABCG5/ABCG8 polymorphisms? A preliminary study in siblings with gallstones." Eur J Intern Med. 17(7):490-494. PMID:17098593
  34. [ + ] Langheim S, et al. (2005) "ABCG5 and ABCG8 require MDR2 for secretion of cholesterol into bile." J Lipid Res. 46(8):1732-1738. PMID:15930516
  35. [ + ] Miwa K, et al. (2005) "ATP-binding cassette transporter G8 M429V polymorphism as a novel genetic marker of higher cholesterol absorption in hypercholesterolaemic Japanese subjects." Clin Sci (Lond). 109(2):183-188. PMID:15816807
  36. [ + ] Yu L, et al. (2005) "Expression of ABCG5 and ABCG8 is required for regulation of biliary cholesterol secretion." J Biol Chem. 280(10):8742-8747. PMID:15611112
  37. [ + ] Plat J, et al. (2005) "Common sequence variations in ABCG8 are related to plant sterol metabolism in healthy volunteers." J Lipid Res. 46(1):68-75. PMID:15520451
  38. [ + ] Gylling H, et al. (2004) "Polymorphisms in the ABCG5 and ABCG8 genes associate with cholesterol absorption and insulin sensitivity." J Lipid Res. 45(9):1660-1665. PMID:15175352
  39. [ + ] Kajinami K, et al. (2004) "ATP binding cassette transporter G5 and G8 genotypes and plasma lipoprotein levels before and after treatment with atorvastatin." J Lipid Res. 45(4):653-656. PMID:14703505
  40. [ + ] Chan DC, et al. (2004) "ATP-binding cassette transporter G8 gene as a determinant of apolipoprotein B-100 kinetics in overweight men." Arterioscler Thromb Vasc Biol. 24(11):2188-2191. PMID:15331430
  41. [ + ] Hubacek JA, et al. (2004) "Polymorphisms in ABCG5 and ABCG8 transporters and plasma cholesterol levels." Physiol Res. 53(4):395-401. PMID:15311998
  42. [ + ] Kajinami K, et al. (2004) "Interactions between common genetic polymorphisms in ABCG5/G8 and CYP7A1 on LDL cholesterol-lowering response to atorvastatin." Atherosclerosis. 175(2):287-293. PMID:15262185
  43. [ + ] Graf GA, et al. (2003) "ABCG5 and ABCG8 are obligate heterodimers for protein trafficking and biliary cholesterol excretion." J Biol Chem. 278(48):48275-48282. PMID:14504269
  44. [ + ] Lu K, et al. (2002) "Molecular cloning, genomic organization, genetic variations, and characterization of murine sterolin genes Abcg5 and Abcg8." J Lipid Res. 43(4):565-578. PMID:11907139
  45. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  46. [ + ] Weggemans RM, et al. (2002) "ATP binding cassette G5 C1950G polymorphism may affect blood cholesterol concentrations in humans." Clin Genet. 62(3):226-229. PMID:12220438
  47. [ + ] Yu L, et al. (2002) "Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol." J Clin Invest. 110(5):671-680. PMID:12208868
  48. [ + ] Graf GA, et al. (2002) "Coexpression of ATP-binding cassette proteins ABCG5 and ABCG8 permits their transport to the apical surface." J Clin Invest. 110(5):659-669. PMID:12208867
  49. [ + ] Remaley AT, et al. (2002) "Comparative genome analysis of potential regulatory elements in the ABCG5-ABCG8 gene cluster." Biochem Biophys Res Commun. 295(2):276-282. PMID:12150943