ABCG5 | GeneID:64240 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 64240 Official Symbol ABCG5
Locus N/A Gene Type protein-coding
Synonyms STSL
Full Name ATP-binding cassette, sub-family G (WHITE), member 5
Description ATP-binding cassette, sub-family G (WHITE), member 5
Chromosome 2p21
Also Known As ATP-binding cassette sub-family G member 5; ATP-binding cassette, subfamily G, member 5; OTTHUMP00000158956; sterolin 1
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. The protein encoded by this gene functions as a half-transporter to limit intestinal absorption and promote biliary excretion of sterols. It is expressed in a tissue-specific manner in the liver, colon, and intestine. This gene is tandemly arrayed on chromosome 2, in a head-to-head orientation with family member ABCG8. Mutations in this gene may contribute to sterol accumulation and atheroschlerosis, and have been observed in patients with sitosterolemia. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 31909

ID Symbol Protein Species
GeneID:27409 Abcg5 NP_114090.1 Mus musculus
GeneID:42976 CG11069 NP_651307.2 Drosophila melanogaster
GeneID:64240 ABCG5 NP_071881.1 Homo sapiens
GeneID:114628 Abcg5 NP_446206.2 Rattus norvegicus
GeneID:421401 ABCG5 XP_419457.2 Gallus gallus
GeneID:481354 ABCG5 XP_538475.1 Canis lupus familiaris
GeneID:515536 ABCG5 NP_001019718.1 Bos taurus
GeneID:557317 LOC557317 XP_684646.1 Danio rerio
GeneID:1281061 AgaP_AGAP002051 XP_320996.2 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab45279 ABCG5 antibody (ab45279); Rabbit polyclonal to ABCG5
2 scbt ABCG5 ABCG5 Antibody / ABCG5 Antibodies;
3 sigma HPA016514 Anti-ABCG5 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCG5 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCG5 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016324 Component apical plasma membrane
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0017127 Function cholesterol transporter activity
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0046982 Function protein heterodimerization activity
GO:0033344 Process cholesterol efflux
GO:0042632 Process cholesterol homeostasis
GO:0007588 Process excretion
GO:0045796 Process negative regulation of intestinal cholesterol absorption
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_022436  UCSC Browser NP_071881

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000260645 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENST00000260645 MI0000748 hsa-miR-130b* ACUCUUUCCCUGUUGCACUAC
ENST00000260645 MI0000449 hsa-miR-132* ACCGUGGCUUUCGAUUGUUACU
ENST00000260645 MI0000273 hsa-miR-183 UAUGGCACUGGUAGAAUUCACU
ENST00000260645 MI0000234 hsa-miR-192 CUGACCUAUGAAUUGACAGCC
ENST00000260645 MI0000487 hsa-miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA
ENST00000260645 MI0000650 hsa-miR-200c* CGUCUUACCCAGCAGUGUUUGG
ENST00000260645 MI0000291 hsa-miR-215 AUGACCUAUGAAUUGACAGAC
ENST00000260645 MI0000293 hsa-miR-217 UACUGCAUCAGGAACUGAUUGGA
ENST00000260645 MI0000301 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU
ENST00000260645 MI0000085 hsa-miR-27a UUCACAGUGGCUAAGUUCCGC
ENST00000260645 MI0000088 hsa-miR-30a UGUAAACAUCCUCGACUGGAAG
ENST00000260645 MI0000441 hsa-miR-30b UGUAAACAUCCUACACUCAGCU
ENST00000260645 MI0000254 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000260645 MI0000736 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000260645 MI0000255 hsa-miR-30d UGUAAACAUCCCCGACUGGAAG
ENST00000260645 MI0000749 hsa-miR-30e UGUAAACAUCCUUGACUGGAAG
ENST00000260645 MI0000808 hsa-miR-326 CCUCUGGGCCCUUCCUCCAG
ENST00000260645 MI0000742 hsa-miR-34b CAAUCACUAACUCCACUGCCAU
ENST00000260645 MI0000762 hsa-miR-362-5p AAUCCUUGGAACCUAGGUGUGAGU
ENST00000260645 MI0001729 hsa-miR-451 AAACCGUUACCAUUACUGAGUU
ENST00000260645 MI0003138 hsa-miR-497* CAAACCACACUGUGGUGUUAGA
ENST00000260645 MI0003184 hsa-miR-500 UAAUCCUUGCUACCUGGGUGAGA
ENST00000260645 MI0003185 hsa-miR-501-5p AAUCCUUUGUCCCUGGGUGAGA
ENST00000260645 MI0003515 hsa-miR-544 AUUCUGCAUUUUUAGCAAGUUC
ENST00000260645 MI0003579 hsa-miR-572 GUCCGCUCGGCGGUGGCCCA
ENST00000260645 MI0003595 hsa-miR-587 UUUCCAUAGGUGAUGAGUCAC
ENST00000260645 MI0003629 hsa-miR-616 AGUCAUUGGAGGGUUUGAGCAG
ENST00000260645 MI0003639 hsa-miR-625* GACUAUAGAACUUUCCCCCUCA
ENST00000260645 MI0005567 hsa-miR-760 CGGCUCUGGGUCUGUGGGGA
ENST00000260645 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENST00000260645 MI0004635 mmu-miR-678 GUCUCGGUGCAAGGACUGGAGG
ENST00000260645 MI0004682 mmu-miR-698 CAUUCUCGUUUCCUUCCCU
ENST00000260645 MI0004691 mmu-miR-707 CAGUCAUGCCGCUUGCCUACG
ENST00000260645 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA
ENST00000260645 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU
ENST00000260645 MI0000644 rno-miR-352 AGAGUAGUAGGUUGCAUAGUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAG40003   AAG53099   AAI11542   AAI72287   AAK85387   AAK85388   AAY14703   AAY24010   EAX00286   EAX00287   EAX00288   NP_071881   Q2T9G2   Q53QN9   Q53T83   Q96QZ2   Q96QZ3   Q9H222  

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
3-DOXYLANDROSTANOL
  • 3-DOXYLANDROSTANOL results in increased activity of [ABCG5 protein binds to ABCG8 protein]
17055487
Androstenedione
  • Androstenedione results in increased activity of [ABCG5 protein binds to ABCG8 protein]
17055487
Bezafibrate
  • Bezafibrate does not affect the expression of ABCG5 mRNA
15242490
Bezafibrate
  • Bezafibrate results in increased expression of ABCG5 mRNA
14685799
Cholates
  • Cholates promotes the reaction [ABCG5 protein results in increased secretion of Cholesterol]
  • Cholates results in increased expression of ABCG5 mRNA
  • Cholates results in increased expression of ABCG5 protein
15611112
Cholesterol
  • ABCG5 protein affects the export of Cholesterol
15696852
Cholesterol
  • ABCG5 protein results in increased secretion of Cholesterol
  • Cholates promotes the reaction [ABCG5 protein results in increased secretion of Cholesterol]
  • Diosgenin promotes the reaction [ABCG5 protein results in increased secretion of Cholesterol]
15611112
Cholesterol
  • [Diosgenin results in increased expression of ABCG5 mRNA] which results in increased secretion of Cholesterol
  • [Ethinyl Estradiol results in decreased expression of ABCG5 mRNA] which results in decreased secretion of Cholesterol
12963437
Cholesterol
  • Cholesterol results in increased expression of ABCG5 mRNA
  • Cholesterol results in decreased expression of ABCG5 mRNA
  • Cholesterol results in increased expression of ABCG5 mRNA
  • [ABCG5 protein binds to ABCG8 protein] which affects the transport of Cholesterol
15683829
Cholesterol
  • Cholesterol results in increased expression of ABCG5 mRNA
15342687
Clofibric Acid
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ABCG5 mRNA
17602206
Dehydroepiandrosterone
  • Dehydroepiandrosterone results in increased activity of [ABCG5 protein binds to ABCG8 protein]
17055487
Dexamethasone
  • Dexamethasone does not affect the expression of ABCG5 mRNA
15683829
dicyclanil
  • dicyclanil results in increased expression of ABCG5 mRNA
15664270
Dietary Fats
  • Dietary Fats results in decreased expression of ABCG5 mRNA
18457598
Diethylnitrosamine
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ABCG5 mRNA
17602206
Diosgenin
  • Diosgenin does not affect the expression of ABCG5 mRNA
15611112, 12763362
Diosgenin
  • Diosgenin promotes the reaction [ABCG5 protein results in increased secretion of Cholesterol]
15611112
Diosgenin
  • Diosgenin does not affect the reaction [Ethinyl Estradiol results in decreased expression of ABCG5 mRNA]
  • Diosgenin results in increased expression of ABCG5 mRNA
  • [Diosgenin results in increased expression of ABCG5 mRNA] which results in increased secretion of Cholesterol
12963437
Diosgenin
  • [Ethinyl Estradiol co-treated with Diosgenin] results in decreased expression of ABCG5 mRNA
16105132
Ethinyl Estradiol
  • ESR1 protein promotes the reaction [Ethinyl Estradiol results in decreased expression of ABCG5 mRNA]
  • Ethinyl Estradiol results in decreased expression of ABCG5 mRNA
16606610
Ethinyl Estradiol
  • Diosgenin does not affect the reaction [Ethinyl Estradiol results in decreased expression of ABCG5 mRNA]
  • [Ethinyl Estradiol results in decreased expression of ABCG5 mRNA] which results in decreased secretion of Cholesterol
12963437
Ethinyl Estradiol
  • [Ethinyl Estradiol co-treated with Diosgenin] results in decreased expression of ABCG5 mRNA
16105132
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of ABCG5 mRNA
17351261, 16105132, 12963437
Ethylnitrosourea
  • Ethylnitrosourea results in increased mutagenesis of ABCG5 gene
16495775
Gemfibrozil
  • Gemfibrozil results in increased expression of ABCG5 mRNA
14685799
GW 3965
  • GW 3965 results in increased expression of ABCG5 mRNA
15633131
Lipopolysaccharides
  • Lipopolysaccharides results in decreased expression of ABCG5 mRNA
15312237
perfluorooctanoic acid
  • perfluorooctanoic acid results in decreased expression of ABCG5 mRNA
17681415
Phytosterols
  • [ABCG5 protein binds to ABCG8 protein] which affects the transport of Phytosterols
15683829
plant stanol ester
  • plant stanol ester results in decreased expression of ABCG5 mRNA
15342687
Pravastatin
  • Pravastatin results in increased expression of ABCG5 mRNA
15242490
Pregnenolone Carbonitrile
  • Pregnenolone Carbonitrile results in increased expression of ABCG5 mRNA
15683829
Procetofen
  • Procetofen results in increased expression of ABCG5 mRNA
14685799
Progesterone
  • Progesterone results in decreased activity of [ABCG5 protein binds to ABCG8 protein]
17055487
Spironolactone
  • Spironolactone results in decreased expression of ABCG5 mRNA
15683829
Sterols
  • ABCG5 protein affects the export of Sterols
15930516
Sterols
  • ABCG5 protein affects the export of Sterols
15737409
Ursodeoxycholic Acid
  • Ursodeoxycholic Acid affects the expression of ABCG5 mRNA
15452192
Vanadates
  • Vanadates results in decreased activity of [ABCG5 protein binds to ABCG8 protein]
17055487

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
SITOSTEROLEMIA marker
Cholestasis inferred via Ursodeoxycholic Acid 16487557
Cholestasis, Intrahepatic inferred via Ursodeoxycholic Acid 14728856
Brain Hemorrhage, Traumatic inferred via Progesterone 17868700
Brain Injuries inferred via Progesterone 15665606, 15845082, 15380490
Breast Neoplasms inferred via Progesterone 17614352, 16175315, 15562024
Diabetic Neuropathies inferred via Progesterone 17187935
Encephalomyelitis, Autoimmune, Experimental inferred via Progesterone 17692515
Endometriosis inferred via Progesterone 16134523
Mammary Neoplasms, Experimental inferred via Progesterone 17203775, 11408345
Ovarian Neoplasms inferred via Progesterone 17393432, 16525653
Salivary Gland Neoplasms inferred via Progesterone 18045962
Spinal Cord Injuries inferred via Progesterone 15862959, 16503802
Dyslipidemias inferred via Procetofen 16707586
Endometrial Neoplasms inferred via Procetofen 16569247
Hypercholesterolemia inferred via Pravastatin 17188708
Myocardial Infarction inferred via Pravastatin 17188708
Edema inferred via perfluorooctanoic acid 17259670, 12083418
Hepatomegaly inferred via perfluorooctanoic acid 3609246
Hyperalgesia inferred via perfluorooctanoic acid 12083418
Inflammation inferred via perfluorooctanoic acid 12083418
Leydig Cell Tumor inferred via perfluorooctanoic acid 8812269
Liver Neoplasms inferred via perfluorooctanoic acid 14757943
Niemann-Pick Disease, Type C inferred via perfluorooctanoic acid 9802331
Prenatal Exposure Delayed Effects inferred via perfluorooctanoic acid 17132714
Hemolytic-Uremic Syndrome inferred via Lipopolysaccharides 16366002
Inflammation inferred via Lipopolysaccharides 17255318, 17963957
Iron Metabolism Disorders inferred via Lipopolysaccharides 17255318
Respiratory Hypersensitivity inferred via Lipopolysaccharides 10835634
Dyslipidemias inferred via Gemfibrozil 16707586
Brain Diseases inferred via Ethylnitrosourea 14991843
Brain Neoplasms inferred via Ethylnitrosourea 16651633, 15144691, 16357521, 16436596, 18412241
Cell Transformation, Neoplastic inferred via Ethylnitrosourea 16003739
Central Nervous System Neoplasms inferred via Ethylnitrosourea 17160924
Ectodermal Dysplasia inferred via Ethylnitrosourea 18357618
Glioblastoma inferred via Ethylnitrosourea 16436596
Glioma inferred via Ethylnitrosourea 16651633, 18412241, 16357521
Kidney Neoplasms inferred via Ethylnitrosourea 17379185
Lung Neoplasms inferred via Ethylnitrosourea 16271038, 17703301, 16019985
Lymphoma inferred via Ethylnitrosourea 15790496
Mammary Neoplasms, Experimental inferred via Ethylnitrosourea 10838139, 18041768, 10767621
Meningioma inferred via Ethylnitrosourea 17943659
Neoplasms, Experimental inferred via Ethylnitrosourea 16707424
Neurilemmoma inferred via Ethylnitrosourea 17160924, 16003739, 16651423
Oligodendroglioma inferred via Ethylnitrosourea 17160924
Thymus Neoplasms inferred via Ethylnitrosourea 15790496
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 15861022, 17333356, 11677210, 16105132, 17681005, 16919318
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Cholestasis inferred via Diosgenin 16105132
Adenoma inferred via Diethylnitrosamine 10737359
Carcinoma, Hepatocellular inferred via Diethylnitrosamine 16878318, 17428255, 10672840, 10737359, 11831363
Liver Neoplasms inferred via Diethylnitrosamine 2422723, 10737359, 18648771, 16942905, 15885732, 12112319
Liver Neoplasms, Experimental inferred via Diethylnitrosamine 16267830, 16842330, 3124819
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Colonic Neoplasms inferred via Dexamethasone 15824018
Liver Cirrhosis, Experimental inferred via Dexamethasone 16718785
Lung Neoplasms inferred via Dexamethasone 15824018, 11195469
Multiple Myeloma inferred via Dexamethasone 15867202, 16118317, 15744524
Respiratory Distress Syndrome, Adult inferred via Dexamethasone 11700416
Adrenal Insufficiency inferred via Dehydroepiandrosterone 17302879
Diabetes Mellitus, Type 1 inferred via Dehydroepiandrosterone 16616286
Mammary Neoplasms, Experimental inferred via Dehydroepiandrosterone 16457693
Osteoporosis, Postmenopausal inferred via Dehydroepiandrosterone 16397352
Liver Neoplasms inferred via Clofibric Acid 17602206
Atherosclerosis inferred via Cholesterol 16632123
Hypercholesterolemia inferred via Cholesterol 16933029
Learning Disorders inferred via Cholesterol 17134702
Niemann-Pick Disease, Type C inferred via Cholesterol 9802331

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ABCG8 ABCG5 / ABCG8 Affinity Capture-Western Graf GA (2002)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Sabeva NS, et al. (2009) "The ABCG5 ABCG8 sterol transporter and phytosterols: implications for cardiometabolic disease." Curr Opin Endocrinol Diabetes Obes. 16(2):172-177. PMID:19306529
  2. [ + ] Ruano G, et al. (2009) "Physiogenomic comparison of edema and BMI in patients receiving rosiglitazone or pioglitazone." Clin Chim Acta. 400(1-2):48-55. PMID:18996102
  3. [ + ] Hirata T, et al. (2009) "Molecular mechanisms of subcellular localization of ABCG5 and ABCG8." Biosci Biotechnol Biochem. 73(3):619-626. PMID:19270375
  4. [ + ] Gylling H, et al. (2009) "The metabolism of plant sterols is disturbed in postmenopausal women with coronary artery disease." Metabolism. 58(3):401-407. PMID:19217458
  5. [ + ] Togo M, et al. (2009) "Identification of a novel mutation for phytosterolemia. Genetic analyses of 2 cases." Clin Chim Acta. 401(1-2):165-169. PMID:19111681
  6. [ + ] Aulchenko YS, et al. (2009) "Loci influencing lipid levels and coronary heart disease risk in 16 European population cohorts." Nat Genet. 41(1):47-55. PMID:19060911
  7. [ + ] Gylling H, et al. (2009) "Long-term consumption of plant stanol and sterol esters, vascular function and genetic regulation." Br J Nutr. 101(11):1688-1695. PMID:19019257
  8. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  9. [ + ] Jiang ZY, et al. (2008) "Increased expression of LXR alpha, ABCG5, ABCG8, and SR-BI in the liver from normolipidemic, nonobese Chinese gallstone patients." J Lipid Res. 49(2):464-472. PMID:18007013
  10. [ + ] Kuo KK, et al. (2008) "Significant association of ABCG5 604Q and ABCG8 D19H polymorphisms with gallstone disease." Br J Surg. 95(8):1005-1011. PMID:18457353
  11. [ + ] Caamano JM, et al. (2008) "Single nucleotide polymorphisms in ABCG5 and ABCG8 genes in Chilean subjects with polygenic hypercholesterolemia and controls." Clin Chem Lab Med. 46(11):1581-1585. PMID:19012522
  12. [ + ] Junyent M, et al. (2008) "The effects of ABCG5/G8 polymorphisms on plasma HDL cholesterol concentrations depend on smoking habit in the Boston Puerto Rican health study." J Lipid Res. ():. PMID:19005228
  13. [ + ] Zhao HL, et al. (2008) "Genetic Variation in ABC G5/G8 and NPC1L1 Impact Cholesterol Response to Plant Sterols in Hypercholesterolemic Men." Lipids. 43(12):1155-1164. PMID:18850127
  14. [ + ] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489
  15. [ + ] Rudkowska I, et al. (2008) "Association between non-responsiveness to plant sterol intervention and polymorphisms in cholesterol metabolism genes: a case-control study." Appl Physiol Nutr Metab. 33(4):728-734. PMID:18641716
  16. [ + ] Chen ZC, et al. (2008) "Significant association of ABCG8:D19H gene polymorphism with hypercholesterolemia and insulin resistance." J Hum Genet. 53(8):757-763. PMID:18581044
  17. [ + ] Rudkowska I, et al. (2008) "Polymorphisms in ABCG5/G8 transporters linked to hypercholesterolemia and gallstone disease." Nutr Rev. 66(6):343-348. PMID:18522623
  18. [ + ] Sumi K, et al. (2007) "Cooperative interaction between hepatocyte nuclear factor 4 alpha and GATA transcription factors regulates ATP-binding cassette sterol transporters ABCG5 and ABCG8." Mol Cell Biol. 27(12):4248-4260. PMID:17403900
  19. [ + ] Santosa S, et al. (2007) "Single nucleotide polymorphisms in ABCG5 and ABCG8 are associated with changes in cholesterol metabolism during weight loss." J Lipid Res. 48(12):2607-2613. PMID:17827468
  20. [ + ] Tachibana S, et al. (2007) "Cholesterol and plant sterol efflux from cultured intestinal epithelial cells is mediated by ATP-binding cassette transporters." Biosci Biotechnol Biochem. 71(8):1886-1895. PMID:17690481
  21. [ + ] Grunhage F, et al. (2007) "Increased gallstone risk in humans conferred by common variant of hepatic ATP-binding cassette transporter for cholesterol." Hepatology. 46(3):793-801. PMID:17626266
  22. [ + ] Wang Y, et al. (2007) "ATP binding cassette G8 T400K polymorphism may affect the risk of gallstone disease among Chinese males." Clin Chim Acta. 384(1-2):80-85. PMID:17612515
  23. [ + ] Wu C, et al. (2007) "Systematic identification of SH3 domain-mediated human protein-protein interactions by peptide array target screening." Proteomics. 7(11):1775-1785. PMID:17474147
  24. [ + ] Lally SE, et al. (2007) "Sitosterol and cholesterol in chylomicrons of type 2 diabetic and non-diabetic subjects: the relationship with ATP binding cassette proteins G5 and G8 and Niemann-Pick C1-like 1 mRNA." Diabetologia. 50(1):217-219. PMID:17102949
  25. [ + ] Herron KL, et al. (2006) "The ABCG5 polymorphism contributes to individual responses to dietary cholesterol and carotenoids in eggs." J Nutr. 136(5):1161-1165. PMID:16614398
  26. [ + ] Miettinen TA, et al. (2006) "Liver transplantation in a patient with sitosterolemia and cirrhosis." Gastroenterology. 130(2):542-547. PMID:16472606
  27. [ + ] Lally S, et al. (2006) "Messenger RNA levels of genes involved in dysregulation of postprandial lipoproteins in type 2 diabetes: the role of Niemann-Pick C1-like 1, ATP-binding cassette, transporters G5 and G8, and of microsomal triglyceride transfer protein." Diabetologia. 49(5):1008-1016. PMID:16518588
  28. [ + ] Engel T, et al. (2006) "Expression and functional characterization of ABCG1 splice variant ABCG1(666)." FEBS Lett. 580(18):4551-4559. PMID:16870176
  29. [ + ] Wang Z, et al. (2006) "Purification and ATP hydrolysis of the putative cholesterol transporters ABCG5 and ABCG8." Biochemistry. 45(32):9929-9939. PMID:16893193
  30. [ + ] Viturro E, et al. (2006) "Cholesterol and saturated fat intake determine the effect of polymorphisms at ABCG5/ABCG8 genes on lipid levels in children." Genet Med. 8(9):594-599. PMID:16980816
  31. [ + ] Muller M, et al. (2006) "Co-expression of human ABCG5 and ABCG8 in insect cells generates an androstan stimulated membrane ATPase activity." FEBS Lett. 580(26):6139-6144. PMID:17055487
  32. [ + ] Acalovschi M, et al. (2006) "Are plasma lipid levels related to ABCG5/ABCG8 polymorphisms? A preliminary study in siblings with gallstones." Eur J Intern Med. 17(7):490-494. PMID:17098593
  33. [ + ] Plat J, et al. (2005) "Common sequence variations in ABCG8 are related to plant sterol metabolism in healthy volunteers." J Lipid Res. 46(1):68-75. PMID:15520451
  34. [ + ] Ohkubo T, et al. (2005) "No genetic association between ATP binding cassette proteins and Japanese sporadic Alzheimer's disease." Dement Geriatr Cogn Disord. 20(2-3):95-98. PMID:15980630
  35. [ + ] Geuken E, et al. (2005) "Hepatic expression of ABC transporters G5 and G8 does not correlate with biliary cholesterol secretion in liver transplant patients." Hepatology. 42(5):1166-1174. PMID:16250035
  36. [ + ] Langheim S, et al. (2005) "ABCG5 and ABCG8 require MDR2 for secretion of cholesterol into bile." J Lipid Res. 46(8):1732-1738. PMID:15930516
  37. [ + ] Miwa K, et al. (2005) "ATP-binding cassette transporter G8 M429V polymorphism as a novel genetic marker of higher cholesterol absorption in hypercholesterolaemic Japanese subjects." Clin Sci (Lond). 109(2):183-188. PMID:15816807
  38. [ + ] Yu L, et al. (2005) "Expression of ABCG5 and ABCG8 is required for regulation of biliary cholesterol secretion." J Biol Chem. 280(10):8742-8747. PMID:15611112
  39. [ + ] Freeman LA, et al. (2004) "The orphan nuclear receptor LRH-1 activates the ABCG5/ABCG8 intergenic promoter." J Lipid Res. 45(7):1197-1206. PMID:15121760
  40. [ + ] Hubacek JA, et al. (2004) "Polymorphisms in ABCG5 and ABCG8 transporters and plasma cholesterol levels." Physiol Res. 53(4):395-401. PMID:15311998
  41. [ + ] Kajinami K, et al. (2004) "Interactions between common genetic polymorphisms in ABCG5/G8 and CYP7A1 on LDL cholesterol-lowering response to atorvastatin." Atherosclerosis. 175(2):287-293. PMID:15262185
  42. [ + ] Gylling H, et al. (2004) "Polymorphisms in the ABCG5 and ABCG8 genes associate with cholesterol absorption and insulin sensitivity." J Lipid Res. 45(9):1660-1665. PMID:15175352
  43. [ + ] Kajinami K, et al. (2004) "ATP binding cassette transporter G5 and G8 genotypes and plasma lipoprotein levels before and after treatment with atorvastatin." J Lipid Res. 45(4):653-656. PMID:14703505
  44. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  45. [ + ] Graf GA, et al. (2003) "ABCG5 and ABCG8 are obligate heterodimers for protein trafficking and biliary cholesterol excretion." J Biol Chem. 278(48):48275-48282. PMID:14504269
  46. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  47. [ + ] Weggemans RM, et al. (2002) "ATP binding cassette G5 C1950G polymorphism may affect blood cholesterol concentrations in humans." Clin Genet. 62(3):226-229. PMID:12220438
  48. [ + ] Yu L, et al. (2002) "Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol." J Clin Invest. 110(5):671-680. PMID:12208868
  49. [ + ] Graf GA, et al. (2002) "Coexpression of ATP-binding cassette proteins ABCG5 and ABCG8 permits their transport to the apical surface." J Clin Invest. 110(5):659-669. PMID:12208867
  50. [ + ] Remaley AT, et al. (2002) "Comparative genome analysis of potential regulatory elements in the ABCG5-ABCG8 gene cluster." Biochem Biophys Res Commun. 295(2):276-282. PMID:12150943