ABCG4 | GeneID:64137 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 64137 Official Symbol ABCG4
Locus N/A Gene Type protein-coding
Synonyms WHITE2
Full Name ATP-binding cassette, sub-family G (WHITE), member 4
Description ATP-binding cassette, sub-family G (WHITE), member 4
Chromosome 11q23.3
Also Known As ATP-binding cassette, subfamily G, member 4; putative ABC transporter
Summary The protein encoded by this gene is included in the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily and is expressed predominantly in liver tissue. The function has not yet been determined but may involve cholesterol transport. Alternate splice variants have been described but their full length sequences have not been determined. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 75179

ID Symbol Protein Species
GeneID:64137 ABCG4 NP_071452.2 Homo sapiens
GeneID:173671 wht-4 NP_494495.2 Caenorhabditis elegans
GeneID:192663 Abcg4 NP_620405.3 Mus musculus
GeneID:300664 Abcg4 XP_236186.2 Rattus norvegicus
GeneID:428242 ABCG4 XP_425801.2 Gallus gallus
GeneID:466802 ABCG4 XP_522202.2 Pan troglodytes
GeneID:508443 ABCG4 XP_585219.3 Bos taurus
GeneID:564842 LOC564842 XP_687685.2 Danio rerio
GeneID:610604 ABCG4 XP_853231.1 Canis lupus familiaris
GeneID:794238 abcg4b NP_001104682.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 scbt ABCG4 ABCG4 Antibody / ABCG4 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCG4 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCG4 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0046982 Function protein heterodimerization activity
GO:0042803 Function protein homodimerization activity
GO:0033344 Process cholesterol efflux
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001142505  UCSC Browser NP_001135977 A8K1B5   Q9H172  
2 NM_022169  UCSC Browser NP_071452 A8K1B5   Q9H172  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000307417 MI0000296 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENST00000307417 MI0000740 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENST00000307417 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENST00000307417 MI0000764 hsa-miR-363 AAUUGCACGGUAUCCAUCUGUA
ENST00000307417 MI0000791 hsa-miR-383 AGAUCAGAAGGUGAUUGUGGCU
ENST00000307417 MI0003161 hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU
ENST00000307417 MI0003165 hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU
ENST00000307417 MI0003174 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU
ENST00000307417 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENST00000307417 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENST00000307417 MI0003649 hsa-miR-634 AACCAGCACCCCAACUUUGGAC
ENST00000307417 MI0003665 hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC
ENST00000307417 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENST00000307417 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
exemestane
  • exemestane results in increased expression of ABCG4 mRNA
17254854

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Breast Neoplasms inferred via exemestane 17952589, 17892469

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Uehara Y, et al. (2008) "ATP-binding cassette transporter G4 is highly expressed in microglia in Alzheimer's brain." Brain Res. 1217():239-246. PMID:18508037
  3. [ + ] Koshiba S, et al. (2008) "Human ABC transporters ABCG2 (BCRP) and ABCG4." Xenobiotica. 38(7-8):863-888. PMID:18668433
  4. [ + ] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489
  5. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  6. [ + ] Christoffersen C, et al. (2006) "Isolation and characterization of human apolipoprotein M-containing lipoproteins." J Lipid Res. 47(8):1833-1843. PMID:16682745
  7. [ + ] Engel T, et al. (2006) "Expression and functional characterization of ABCG1 splice variant ABCG1(666)." FEBS Lett. 580(18):4551-4559. PMID:16870176
  8. [ + ] Vaughan AM, et al. (2006) "ABCA1 and ABCG1 or ABCG4 act sequentially to remove cellular cholesterol and generate cholesterol-rich HDL." J Lipid Res. 47(11):2433-2443. PMID:16902247
  9. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  10. [ + ] Cserepes J, et al. (2004) "Functional expression and characterization of the human ABCG1 and ABCG4 proteins: indications for heterodimerization." Biochem Biophys Res Commun. 320(3):860-867. PMID:15240127
  11. [ + ] Oldfield S, et al. (2002) "ABCG4: a novel human white family ABC-transporter expressed in the brain and eye." Biochim Biophys Acta. 1591(1-3):175-179. PMID:12183068
  12. [ + ] Yoshikawa M, et al. (2002) "Molecular and cytogenetic characterization of the mouse ATP-binding cassette transporter Abcg4." Gene. 293(1-2):67-75. PMID:12137944
  13. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  14. [ + ] Annilo T, et al. (2001) "Human and mouse orthologs of a new ATP-binding cassette gene, ABCG4." Cytogenet Cell Genet. 94(3-4):196-201. PMID:11856881
  15. [ + ] Engel T, et al. (2001) "The human ABCG4 gene is regulated by oxysterols and retinoids in monocyte-derived macrophages." Biochem Biophys Res Commun. 288(2):483-488. PMID:11606068
  16. [ + ] Dean M, et al. (2001) "The human ATP-binding cassette (ABC) transporter superfamily." Genome Res. 11(7):1156-1166. PMID:11435397