Abcb9 | GeneID:63886 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 63886 Official Symbol Abcb9
Locus N/A Gene Type protein-coding
Synonyms Tapl
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 9
Description ATP-binding cassette, sub-family B (MDR/TAP), member 9
Chromosome 12q15
Also Known As TAP-like ABC transporter
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 10491

ID Symbol Protein Species
GeneID:23457 ABCB9 NP_982269.1 Homo sapiens
GeneID:56325 Abcb9 NP_063928.2 Mus musculus
GeneID:63886 Abcb9 NP_071574.1 Rattus norvegicus
GeneID:416834 ABCB9 XP_415125.2 Gallus gallus
GeneID:452335 ABCB9 XP_509453.2 Pan troglodytes
GeneID:477456 ABCB9 XP_849373.1 Canis lupus familiaris
GeneID:570148 DKEY-21K4.3 XP_698681.3 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0043190 Component ATP-binding cassette (ABC) transporter complex
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_022238  UCSC Browser NP_071574

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000001439 MI0003161 hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU
ENSRNOT00000001439 MI0003174 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU
ENSRNOT00000001439 MI0003600 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSRNOT00000001439 MI0003601 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSRNOT00000001439 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENSRNOT00000001439 MI0005758 hsa-miR-936 ACAGUAGAGGGAGGAAUCGCAG
ENSRNOT00000001439 MI0000827 rno-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSRNOT00000001439 MI0000828 rno-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSRNOT00000001439 MI0000829 rno-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENSRNOT00000001439 MI0000830 rno-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSRNOT00000001439 MI0000831 rno-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSRNOT00000001439 MI0000601 rno-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENSRNOT00000001439 MI0000833 rno-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSRNOT00000001439 MI0000834 rno-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSRNOT00000001439 MI0000906 rno-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSRNOT00000001439 MI0003490 rno-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENSRNOT00000001439 MI0000918 rno-miR-145 GUCCAGUUUUCCCAGGAAUCCCU
ENSRNOT00000001439 MI0000920 rno-miR-150 UCUCCCAACCCUUGUACCAGUG
ENSRNOT00000001439 MI0001152 rno-miR-196b UAGGUAGUUUCCUGUUGUUGGG
ENSRNOT00000001439 MI0000872 rno-miR-31 AGGCAAGAUGCUGGCAUAGCUG
ENSRNOT00000001439 MI0000596 rno-miR-325-3p UUUAUUGAGCACCUCCUAUCAA
ENSRNOT00000001439 MI0006154 rno-miR-532-3p CCUCCCACACCCAAGGCUUGCA
ENSRNOT00000001439 MI0003524 rno-miR-540 AGGUCAGAGGUCGAUCCUGG
ENSRNOT00000001439 MI0000882 rno-miR-98 UGAGGUAGUAAGUUGUAUUGUU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

BAA85306   BAD10852   BAD10853   EDM13606   NP_071574   Q764Q5   Q764Q6   Q9QYJ4  

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Yamaguchi Y, et al. (2004) "The carboxyl terminal sequence of rat transporter associated with antigen processing (TAP)-like (ABCB9) is heterogeneous due to splicing of its mRNA." Biol Pharm Bull. 27(1):100-104. PMID:14709908
  2. [ + ] Yamaguchi Y, et al. (1999) "An ABC transporter homologous to TAP proteins." FEBS Lett. 457(2):231-236. PMID:10471785